pycom13g28380

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
24245477 .. 24246032
556 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g28380.2

Sequence Viewer

Length: 414 bp
ATGCTTGGAGCCAAAGTGTTGGACGAAATTGAAGACCTAATTGAAGACCAAAGTGTTGGAACCTTGTTCTCTTTAGTTTTAGGACATTTAAAACCTTTCCTAATCCCAATCATGCCATGCATAACACACATCCATTCTAACACATTGTCATTGCACATGCATTTCCTTCATTACATACACTTATCACTCATAATCACCTACAACATCCACCTACTTCACCTACAACATCCACCTACTTCACCTACAAATGACATAGCCATATGTTCCCTCCACTACTCCTATAAATACCCTTGCATTCATTCATTCAAAATTCACATCTCATTTCATACACAACACACCACAAACACTTCCATTCCTTCTCTTTGCCGTGAGTTCCCTTGTAATCCAAACACCATTTTTCCATTTCCCTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.75

Weight (kDa)

6.54

Isoelectric Point (pI)

53.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 309
AgsI TTSAA 3 cut(s) 32, 44, 307
ApoI RAATTY 1 cut(s) 309
AsuHPI GGTGA 3 cut(s) 187, 209, 231
BbsI GAAGAC 2 cut(s) 39, 51
BceAI ACGGC 1 cut(s) 351
BmiI GGNNCC 2 cut(s) 10, 61
BpiI GAAGAC 2 cut(s) 39, 51
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bse3DI GCAATG 1 cut(s) 149
BseGI GGATG 3 cut(s) 129, 204, 226
BseMI GCAATG 1 cut(s) 149
BsmI GAATGC 1 cut(s) 294
BspLI GGNNCC 2 cut(s) 10, 61
BsrDI GCAATG 1 cut(s) 149
BstF5I GGATG 3 cut(s) 129, 204, 226
BstNSI RCATGY 1 cut(s) 160
BstV2I GAAGAC 2 cut(s) 39, 51
BstXI CCANNNNNNTGG 2 cut(s) 19, 56
BtsCI GGATG 3 cut(s) 129, 204, 226
CviAII CATG 3 cut(s) 112, 117, 157
CviJI RGCY 2 cut(s) 11, 257
CviKI_1 RGCY 2 cut(s) 11, 257
DraI TTTAAA 1 cut(s) 90
EcoT22I ATGCAT 2 cut(s) 122, 162
FaeI CATG 3 cut(s) 115, 120, 160
FatI CATG 3 cut(s) 111, 116, 156
FauNDI CATATG 1 cut(s) 260
FokI GGATG 3 cut(s) 116, 191, 213
Hin1II CATG 3 cut(s) 115, 120, 160
HphI GGTGA 3 cut(s) 187, 209, 231
HpyAV CCTTC 2 cut(s) 176, 366
HpyCH4V TGCA 4 cut(s) 120, 154, 160, 294
Hsp92II CATG 3 cut(s) 115, 120, 160
LmnI GCTCC 1 cut(s) 8
MboII GAAGA 2 cut(s) 44, 56
MluCI AATT 3 cut(s) 27, 39, 309
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 278
Mph1103I ATGCAT 2 cut(s) 122, 162
MseI TTAA 2 cut(s) 89, 412
Mva1269I GAATGC 1 cut(s) 294
NdeI CATATG 1 cut(s) 260
NlaIII CATG 3 cut(s) 115, 120, 160
NlaIV GGNNCC 2 cut(s) 10, 61
NsiI ATGCAT 2 cut(s) 122, 162
NspI RCATGY 1 cut(s) 160
PctI GAATGC 1 cut(s) 294
PspN4I GGNNCC 2 cut(s) 10, 61
SaqAI TTAA 2 cut(s) 89, 412
SetI ASST 8 cut(s) 39, 65, 97, 200, 213, 222, 235, 244
SgeI CNNG 8 cut(s) 17, 76, 124, 129, 169, 303, 380, 390
Sse9I AATT 3 cut(s) 27, 39, 309
TasI AATT 3 cut(s) 27, 39, 309
Tru1I TTAA 2 cut(s) 89, 412
Tru9I TTAA 2 cut(s) 89, 412
TspDTI ATGAA 4 cut(s) 158, 287, 291, 314
XapI RAATTY 1 cut(s) 309
XceI RCATGY 1 cut(s) 160
Zsp2I ATGCAT 2 cut(s) 122, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.