pycom266g00030

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000266
Physical Location & Seq
Forward (+)
45966 .. 46409
444 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom266g00030.1

Sequence Viewer

Length: 444 bp
ATGCATTTCCACCCTTTAATCACATGCATAAATCAGCCACATGCATCTCCCATCACCATTCCAGATTTCCACCAAGTTCCTAGCTGTCATGTTCCCCCCATTTCACCTATAAATAAGCATCCATTGCAGCCACAATTCAAGCATTCCATTCACAACACAAAACACACACTCTTCCACCACAGAAATTCATCCATTCACTCCACCATTCCATCCATTAACACACCTCAACTCATTCACTCTTCCATATTCCAGAAATTCGTCAAAACCTCTCCACACCCTTGCAGCAGCCACCAAAACACTTTTCTCCTCCATTGCAGCCACTCCAACCACTCCCCAAACCATTCACACCATCAAATTATCCTTAGACCTTGTGCTACAACGAAGAGGAAGATAAGAGGGCCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.8

Weight (kDa)

10.16

Isoelectric Point (pI)

63.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 406
AcsI RAATTY 2 cut(s) 184, 254
AgsI TTSAA 2 cut(s) 139, 420
AjuI GAANNNNNNNTTGG 2 cut(s) 285, 317
AluBI AGCT 1 cut(s) 84
AluI AGCT 1 cut(s) 84
AoxI GGCC 1 cut(s) 398
ApeKI GCWGC 4 cut(s) 127, 282, 285, 315
ApoI RAATTY 2 cut(s) 184, 254
AspS9I GGNCC 1 cut(s) 398
AsuHPI GGTGA 2 cut(s) 46, 96
BbvI GCAGC 4 cut(s) 139, 294, 297, 327
BccI CCATC 3 cut(s) 59, 217, 357
BfaI CTAG 1 cut(s) 81
BisI GCNGC 4 cut(s) 128, 283, 286, 316
BlsI GCNGC 4 cut(s) 129, 284, 287, 317
BmgT120I GGNCC 1 cut(s) 398
BmsI GCATC 2 cut(s) 53, 127
Bse3DI GCAATG 2 cut(s) 122, 310
BseGI GGATG 3 cut(s) 118, 188, 209
BseMI GCAATG 2 cut(s) 122, 310
BseRI GAGGAG 1 cut(s) 296
BseXI GCAGC 4 cut(s) 139, 294, 297, 327
BshFI GGCC 1 cut(s) 400
BsmI GAATGC 1 cut(s) 142
BsnI GGCC 1 cut(s) 400
BspANI GGCC 1 cut(s) 400
BsrDI GCAATG 2 cut(s) 122, 310
Bst6I CTCTTC 3 cut(s) 176, 244, 377
BstAPI GCANNNNNTGC 1 cut(s) 124
BstDEI CTNAG 1 cut(s) 362
BstF5I GGATG 3 cut(s) 118, 188, 209
BstMWI GCNNNNNNNGC 1 cut(s) 124
BstNSI RCATGY 2 cut(s) 27, 44
BstV1I GCAGC 4 cut(s) 139, 294, 297, 327
BsuRI GGCC 1 cut(s) 400
BtsCI GGATG 3 cut(s) 118, 188, 209
Cfr13I GGNCC 1 cut(s) 398
CviAII CATG 3 cut(s) 24, 41, 89
CviJI RGCY 6 cut(s) 37, 84, 130, 288, 318, 400
CviKI_1 RGCY 6 cut(s) 37, 84, 130, 288, 318, 400
DdeI CTNAG 1 cut(s) 362
Eam1104I CTCTTC 3 cut(s) 176, 244, 377
EarI CTCTTC 3 cut(s) 176, 244, 377
EcoO109I RGGNCCY 1 cut(s) 398
EcoT22I ATGCAT 3 cut(s) 6, 29, 46
FaeI CATG 3 cut(s) 27, 44, 92
FaiI YATR 7 cut(s) 25, 29, 42, 90, 110, 245, 412
FatI CATG 3 cut(s) 23, 40, 88
Fnu4HI GCNGC 4 cut(s) 128, 283, 286, 316
FokI GGATG 3 cut(s) 105, 175, 196
Fsp4HI GCNGC 4 cut(s) 128, 283, 286, 316
FspBI CTAG 1 cut(s) 81
GluI GCNGC 4 cut(s) 128, 283, 286, 316
HaeIII GGCC 1 cut(s) 400
Hin1II CATG 3 cut(s) 27, 44, 92
HphI GGTGA 2 cut(s) 46, 96
Hpy188III TCNNGA 2 cut(s) 62, 250
HpyCH4IV ACGT 1 cut(s) 406
HpyCH4V TGCA 6 cut(s) 4, 27, 44, 127, 282, 315
HpyF10VI GCNNNNNNNGC 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 362
HpySE526I ACGT 1 cut(s) 406
Hsp92II CATG 3 cut(s) 27, 44, 92
LpnPI CCDG 2 cut(s) 75, 263
Lsp1109I GCAGC 4 cut(s) 139, 294, 297, 327
LweI GCATC 2 cut(s) 53, 127
MaeI CTAG 1 cut(s) 81
MaeII ACGT 1 cut(s) 406
MboII GAAGA 4 cut(s) 163, 231, 394, 400
MluCI AATT 5 cut(s) 134, 184, 254, 354, 415
MmeI TCCRAC 2 cut(s) 348, 413
MnlI CCTC 5 cut(s) 234, 277, 317, 378, 389
Mph1103I ATGCAT 3 cut(s) 6, 29, 46
MseI TTAA 2 cut(s) 17, 216
Mva1269I GAATGC 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 124
NlaIII CATG 3 cut(s) 27, 44, 92
NsiI ATGCAT 3 cut(s) 6, 29, 46
NspI RCATGY 2 cut(s) 27, 44
PctI GAATGC 1 cut(s) 142
PkrI GCNGC 4 cut(s) 129, 284, 287, 317
Psp1406I AACGTT 1 cut(s) 406
PspPI GGNCC 1 cut(s) 398
SaqAI TTAA 2 cut(s) 17, 216
SatI GCNGC 4 cut(s) 128, 283, 286, 316
Sau96I GGNCC 1 cut(s) 398
SetI ASST 6 cut(s) 86, 109, 226, 269, 370, 409
SfaNI GCATC 2 cut(s) 53, 127
Sse9I AATT 5 cut(s) 134, 184, 254, 354, 415
SspMI CTAG 1 cut(s) 81
TaiI ACGT 1 cut(s) 409
TasI AATT 5 cut(s) 134, 184, 254, 354, 415
Tru1I TTAA 2 cut(s) 17, 216
Tru9I TTAA 2 cut(s) 17, 216
TseI GCWGC 4 cut(s) 127, 282, 285, 315
TspDTI ATGAA 2 cut(s) 177, 399
XapI RAATTY 2 cut(s) 184, 254
XceI RCATGY 2 cut(s) 27, 44
XspI CTAG 1 cut(s) 81
Zsp2I ATGCAT 3 cut(s) 6, 29, 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.