pycom01g00800

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
756793 .. 757242
450 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g00800.1

Sequence Viewer

Length: 450 bp
ATGCAATTACAAAACATCATCATAACCCACCTACAACCCACCTACAACCCACCTACAATCCACCTAATTCACAAAGCTTTTCCCAACAAACAATTTCACCAAACACATGCACCCAAAACCTTCAATGCCGTGGGGTCCCAATTGCAGCCACATTCTCACCCACTCTCTCCCTATATAAACCACACACACTTCATTCATTTGTCATTCATTCACTCCCCACTCCAACATCTCATTTCATACACAACACACCATAAACACATCCCTTTCTCTCTTAGCCGTGAGTCTCCCTTAGAATCCAAAAACCATCTTTCCATTTCCATCACTCCTCACTCCATTCCACACTTCCATTCCCCCAAACCAACTATCCTTAGACCTTATGCTACAATAAAGAGGAAGAGAAGAGGGCCTAAACGTTCATACAATTCAAGTTTGAGTTGTTGGAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

150

Amino Acids

17.27

Weight (kDa)

10.53

Isoelectric Point (pI)

78.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 412
AgsI TTSAA 2 cut(s) 124, 426
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 288
AoxI GGCC 1 cut(s) 404
ApeKI GCWGC 1 cut(s) 145
AspS9I GGNCC 2 cut(s) 135, 404
AsuHPI GGTGA 2 cut(s) 89, 149
AvaII GGWCC 1 cut(s) 135
BbvI GCAGC 1 cut(s) 157
BccI CCATC 2 cut(s) 312, 326
BceAI ACGGC 2 cut(s) 113, 261
BcoDI GTCTC 1 cut(s) 288
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 2 cut(s) 135, 404
BmiI GGNNCC 2 cut(s) 136, 137
BsaJI CCNNGG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 1 cut(s) 258
BseRI GAGGAG 1 cut(s) 315
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 1 cut(s) 406
BslFI GGGAC 1 cut(s) 121
BsmAI GTCTC 1 cut(s) 288
BsmFI GGGAC 1 cut(s) 121
BsnI GGCC 1 cut(s) 406
BspANI GGCC 1 cut(s) 406
BspLI GGNNCC 2 cut(s) 136, 137
BssECI CCNNGG 1 cut(s) 129
Bst6I CTCTTC 2 cut(s) 389, 394
BstDEI CTNAG 3 cut(s) 272, 289, 368
BstDSI CCRYGG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 258
BstMAI GTCTC 1 cut(s) 288
BstNSI RCATGY 1 cut(s) 110
BstV1I GCAGC 1 cut(s) 157
BsuRI GGCC 1 cut(s) 406
BtgI CCRYGG 1 cut(s) 129
BtsCI GGATG 1 cut(s) 258
Cfr13I GGNCC 2 cut(s) 135, 404
CviAII CATG 1 cut(s) 107
CviJI RGCY 4 cut(s) 77, 148, 276, 406
CviKI_1 RGCY 4 cut(s) 77, 148, 276, 406
DdeI CTNAG 3 cut(s) 272, 289, 368
Eam1104I CTCTTC 2 cut(s) 389, 394
EarI CTCTTC 2 cut(s) 389, 394
Eco47I GGWCC 1 cut(s) 135
EcoO109I RGGNCCY 2 cut(s) 135, 404
FaeI CATG 1 cut(s) 110
FaiI YATR 8 cut(s) 23, 108, 174, 176, 238, 252, 378, 418
FaqI GGGAC 1 cut(s) 121
FatI CATG 1 cut(s) 106
Fnu4HI GCNGC 1 cut(s) 146
FokI GGATG 1 cut(s) 245
Fsp4HI GCNGC 1 cut(s) 146
GluI GCNGC 1 cut(s) 146
HaeIII GGCC 1 cut(s) 406
Hin1II CATG 1 cut(s) 110
HindIII AAGCTT 1 cut(s) 75
HinfI GANTC 2 cut(s) 281, 293
HphI GGTGA 2 cut(s) 89, 149
HpyAV CCTTC 1 cut(s) 130
HpyCH4IV ACGT 1 cut(s) 412
HpyCH4V TGCA 3 cut(s) 4, 110, 145
HpyF3I CTNAG 3 cut(s) 272, 289, 368
HpySE526I ACGT 1 cut(s) 412
Hsp92II CATG 1 cut(s) 110
KflI GGGWCCC 1 cut(s) 135
Lsp1109I GCAGC 1 cut(s) 157
MaeII ACGT 1 cut(s) 412
MboII GAAGA 2 cut(s) 406, 411
MfeI CAATTG 1 cut(s) 140
MluCI AATT 5 cut(s) 5, 66, 92, 140, 421
MlyI GAGTC 1 cut(s) 290
MmeI TCCRAC 2 cut(s) 247, 419
MnlI CCTC 3 cut(s) 336, 384, 395
MunI CAATTG 1 cut(s) 140
NlaIII CATG 1 cut(s) 110
NlaIV GGNNCC 2 cut(s) 136, 137
NspI RCATGY 1 cut(s) 110
PfeI GAWTC 1 cut(s) 293
PkrI GCNGC 1 cut(s) 147
PleI GAGTC 1 cut(s) 289
PpsI GAGTC 1 cut(s) 289
PpuMI RGGWCCY 1 cut(s) 135
Psp1406I AACGTT 1 cut(s) 412
Psp5II RGGWCCY 1 cut(s) 135
PspN4I GGNNCC 2 cut(s) 136, 137
PspPI GGNCC 2 cut(s) 135, 404
PspPPI RGGWCCY 1 cut(s) 135
SatI GCNGC 1 cut(s) 146
Sau96I GGNCC 2 cut(s) 135, 404
SchI GAGTC 1 cut(s) 290
SetI ASST 8 cut(s) 33, 44, 55, 66, 79, 122, 376, 415
SgeI CNNG 4 cut(s) 119, 142, 290, 438
SinI GGWCC 1 cut(s) 135
Sse9I AATT 5 cut(s) 5, 66, 92, 140, 421
TaiI ACGT 1 cut(s) 415
TasI AATT 5 cut(s) 5, 66, 92, 140, 421
TfiI GAWTC 1 cut(s) 293
TseI GCWGC 1 cut(s) 145
TspDTI ATGAA 5 cut(s) 181, 185, 196, 225, 405
VpaK11BI GGWCC 1 cut(s) 135
XceI RCATGY 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.