pycom12g15990

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
18445967 .. 18446407
441 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g15990.2

Sequence Viewer

Length: 213 bp
ATGCTTGCTAGGTGCTTCTGTATACCTCTCGTATCTATTCGTGTGGGGAAGATCAAGAAGCAAGGGACTCTCTTGTGTCCCACTGCTGCTAGCATTTCGAGCCGGCGGAAGTTGGAATGCTTGCTAGGTGCTTCTGTATACCTCTCGTATCTATTCGTGTGGGGAACGATCGATCAACAAGCAAGGGACTCTCTTGTGTCCCACTGCTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.72

Weight (kDa)

9.3

Isoelectric Point (pI)

31.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 22, 138
AciI CCGC 1 cut(s) 106
ApeKI GCWGC 2 cut(s) 86, 207
AsuNHI GCTAGC 1 cut(s) 89
BbvI GCAGC 2 cut(s) 73, 194
BfaI CTAG 4 cut(s) 9, 90, 125, 211
BisI GCNGC 2 cut(s) 87, 208
BlsI GCNGC 2 cut(s) 88, 209
BmtI GCTAGC 1 cut(s) 93
Bsa29I ATCGAT 1 cut(s) 171
Bse118I RCCGGY 1 cut(s) 102
BseCI ATCGAT 1 cut(s) 171
BseXI GCAGC 2 cut(s) 73, 194
Bsh1285I CGRYCG 1 cut(s) 171
BshVI ATCGAT 1 cut(s) 171
BsiEI CGRYCG 1 cut(s) 171
BsiSI CCGG 1 cut(s) 103
BslFI GGGAC 4 cut(s) 63, 79, 184, 200
BsmFI GGGAC 4 cut(s) 63, 79, 184, 200
BsmI GAATGC 1 cut(s) 122
Bsp143I GATC 3 cut(s) 51, 168, 172
BspACI CCGC 1 cut(s) 106
BspDI ATCGAT 1 cut(s) 171
BspOI GCTAGC 1 cut(s) 93
BsrFI RCCGGY 1 cut(s) 102
BssAI RCCGGY 1 cut(s) 102
BssMI GATC 3 cut(s) 51, 168, 172
BssNAI GTATAC 2 cut(s) 23, 139
Bst1107I GTATAC 2 cut(s) 23, 139
BstC8I GCNNGC 4 cut(s) 6, 91, 104, 122
BstKTI GATC 3 cut(s) 54, 171, 175
BstMBI GATC 3 cut(s) 51, 168, 172
BstMCI CGRYCG 1 cut(s) 171
BstMWI GCNNNNNNNGC 1 cut(s) 99
BstV1I GCAGC 2 cut(s) 73, 194
BstZ17I GTATAC 2 cut(s) 23, 139
Bsu15I ATCGAT 1 cut(s) 171
BsuTUI ATCGAT 1 cut(s) 171
BtsI GCAGTG 2 cut(s) 81, 202
BtsIMutI CAGTG 2 cut(s) 81, 202
Cac8I GCNNGC 4 cut(s) 6, 91, 104, 122
Cfr10I RCCGGY 1 cut(s) 102
ClaI ATCGAT 1 cut(s) 171
CviJI RGCY 1 cut(s) 102
CviKI_1 RGCY 1 cut(s) 102
DpnI GATC 3 cut(s) 53, 170, 174
DpnII GATC 3 cut(s) 51, 168, 172
EciI GGCGGA 1 cut(s) 121
FaiI YATR 2 cut(s) 23, 139
FaqI GGGAC 4 cut(s) 63, 79, 184, 200
FblI GTMKAC 2 cut(s) 22, 138
Fnu4HI GCNGC 2 cut(s) 87, 208
Fsp4HI GCNGC 2 cut(s) 87, 208
FspBI CTAG 4 cut(s) 9, 90, 125, 211
GluI GCNGC 2 cut(s) 87, 208
HapII CCGG 1 cut(s) 103
HinfI GANTC 2 cut(s) 67, 188
HpaII CCGG 1 cut(s) 103
Hpy166II GTNNAC 2 cut(s) 23, 139
Hpy188III TCNNGA 1 cut(s) 55
Hpy8I GTNNAC 2 cut(s) 23, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 99
KroI GCCGGC 1 cut(s) 102
KroNI GCCGGC 1 cut(s) 104
Kzo9I GATC 3 cut(s) 51, 168, 172
LpnPI CCDG 1 cut(s) 116
Lsp1109I GCAGC 2 cut(s) 73, 194
MaeI CTAG 4 cut(s) 9, 90, 125, 211
MalI GATC 3 cut(s) 53, 170, 174
MboI GATC 3 cut(s) 51, 168, 172
MboII GAAGA 1 cut(s) 61
MlyI GAGTC 2 cut(s) 61, 182
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 2 cut(s) 36, 152
MroNI GCCGGC 1 cut(s) 102
MspI CCGG 1 cut(s) 103
Mva1269I GAATGC 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 99
NaeI GCCGGC 1 cut(s) 104
NdeII GATC 3 cut(s) 51, 168, 172
NgoMIV GCCGGC 1 cut(s) 102
NheI GCTAGC 1 cut(s) 89
PctI GAATGC 1 cut(s) 122
PdiI GCCGGC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 88, 209
Ple19I CGATCG 1 cut(s) 171
PleI GAGTC 2 cut(s) 61, 182
PpsI GAGTC 2 cut(s) 61, 182
PvuI CGATCG 1 cut(s) 171
SatI GCNGC 2 cut(s) 87, 208
Sau3AI GATC 3 cut(s) 51, 168, 172
SchI GAGTC 2 cut(s) 61, 182
SetI ASST 4 cut(s) 14, 28, 130, 144
SsiI CCGC 1 cut(s) 106
SspMI CTAG 4 cut(s) 9, 90, 125, 211
TaqI TCGA 2 cut(s) 98, 171
TscAI CASTG 2 cut(s) 88, 209
TseI GCWGC 2 cut(s) 86, 207
TspRI CASTG 2 cut(s) 88, 209
XmiI GTMKAC 2 cut(s) 22, 138
XspI CTAG 4 cut(s) 9, 90, 125, 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.