Rh2AG053000

Novel plant snare

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000840
Physical Location & Seq
Forward (+)
4151157 .. 4184540
33384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG053000.1

Sequence Viewer

Length: 180 bp
ATGGCTCTCATGCATGTTATTGGAACTTCCTCTCATGTTGGCCTCCTCAAAATTCGTTTGGGGTTAACTGAAATTGTGGGTATTTCAGGTATGACACATCAGCAACTTATTGATCATGGACACCAAATGATGGATGAGACTGATCAAGCGATTGATAGAGCACAAAGCTGCAATAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec20

Protein Analysis

59

Amino Acids

6.45

Weight (kDa)

5.83

Isoelectric Point (pI)

33.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 130
AcsI RAATTY 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 130
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
Alw21I GWGCWC 1 cut(s) 163
Alw26I GTCTC 1 cut(s) 131
AoxI GGCC 1 cut(s) 40
ApeKI GCWGC 1 cut(s) 168
ApoI RAATTY 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 163
BbvI GCAGC 1 cut(s) 155
BccI CCATC 1 cut(s) 124
BclI TGATCA 2 cut(s) 112, 142
BcoDI GTCTC 1 cut(s) 131
BfaI CTAG 1 cut(s) 178
BisI GCNGC 1 cut(s) 169
BlsI GCNGC 1 cut(s) 170
Bsc4I CCNNNNNNNGG 1 cut(s) 130
BseGI GGATG 1 cut(s) 139
BseLI CCNNNNNNNGG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 35
BseXI GCAGC 1 cut(s) 155
BshFI GGCC 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 131
BsnI GGCC 1 cut(s) 42
Bsp1286I GDGCHC 1 cut(s) 163
Bsp143I GATC 2 cut(s) 112, 142
BspANI GGCC 1 cut(s) 42
BssMI GATC 2 cut(s) 112, 142
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 2 cut(s) 115, 145
BstMAI GTCTC 1 cut(s) 131
BstMBI GATC 2 cut(s) 112, 142
BstNSI RCATGY 1 cut(s) 17
BstV1I GCAGC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 42
BtsCI GGATG 1 cut(s) 139
CviAII CATG 4 cut(s) 10, 14, 35, 116
CviJI RGCY 3 cut(s) 5, 42, 168
CviKI_1 RGCY 3 cut(s) 5, 42, 168
DpnI GATC 2 cut(s) 114, 144
DpnII GATC 2 cut(s) 112, 142
EcoT22I ATGCAT 1 cut(s) 15
FaeI CATG 4 cut(s) 13, 17, 38, 119
FaiI YATR 5 cut(s) 11, 15, 36, 92, 117
FatI CATG 4 cut(s) 9, 13, 34, 115
FbaI TGATCA 2 cut(s) 112, 142
Fnu4HI GCNGC 1 cut(s) 169
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 1 cut(s) 169
FspBI CTAG 1 cut(s) 178
GluI GCNGC 1 cut(s) 169
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 4 cut(s) 13, 17, 38, 119
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HpaI GTTAAC 1 cut(s) 66
Hpy166II GTNNAC 1 cut(s) 66
Hpy8I GTNNAC 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 13, 171
Hsp92II CATG 4 cut(s) 13, 17, 38, 119
Ksp22I TGATCA 2 cut(s) 112, 142
KspAI GTTAAC 1 cut(s) 66
Kzo9I GATC 2 cut(s) 112, 142
LpnPI CCDG 1 cut(s) 72
Lsp1109I GCAGC 1 cut(s) 155
MaeI CTAG 1 cut(s) 178
MalI GATC 2 cut(s) 114, 144
MboI GATC 2 cut(s) 112, 142
MhlI GDGCHC 1 cut(s) 163
MluCI AATT 2 cut(s) 51, 72
MnlI CCTC 3 cut(s) 40, 53, 56
Mph1103I ATGCAT 1 cut(s) 15
MseI TTAA 1 cut(s) 65
NdeII GATC 2 cut(s) 112, 142
NlaIII CATG 4 cut(s) 13, 17, 38, 119
NsiI ATGCAT 1 cut(s) 15
NspI RCATGY 1 cut(s) 17
PflMI CCANNNNNTGG 1 cut(s) 130
PkrI GCNGC 1 cut(s) 170
SaqAI TTAA 1 cut(s) 65
SatI GCNGC 1 cut(s) 169
Sau3AI GATC 2 cut(s) 112, 142
SduI GDGCHC 1 cut(s) 163
SetI ASST 2 cut(s) 91, 170
SgeI CNNG 6 cut(s) 22, 26, 47, 99, 128, 158
Sse9I AATT 2 cut(s) 51, 72
SspMI CTAG 1 cut(s) 178
TasI AATT 2 cut(s) 51, 72
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TseI GCWGC 1 cut(s) 168
Van91I CCANNNNNTGG 1 cut(s) 130
XapI RAATTY 1 cut(s) 51
XceI RCATGY 1 cut(s) 17
XspI CTAG 1 cut(s) 178
Zsp2I ATGCAT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.