Rroxscaffold_5G00352750

Novel plant snare

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000840
Physical Location & Seq
Reverse (-)
30013794 .. 30020920
7127 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00352750.1

Sequence Viewer

Length: 156 bp
ATGACAAATCAGCAACTTATTGATCACGGACACCAAATAAGGGATGAGACTGATCAAGCCATTGATAGAGCACAAAGGTTCTTCATCAGACTATCAACTGGGGACTATGACTTTGACAATGCTTTTGGGGTTCTCTGCAGTATATGCAGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec20

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

4.9

Isoelectric Point (pI)

9.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 40
Alw21I GWGCWC 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 41
ArsI GACNNNNNNTTYG 4 cut(s) 95, 107, 127, 139
Bbv12I GWGCWC 1 cut(s) 73
BclI TGATCA 2 cut(s) 22, 52
BcoDI GTCTC 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 136
BfuAI ACCTGC 1 cut(s) 138
BmrI ACTGGG 1 cut(s) 108
BmuI ACTGGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 40
BseNI ACTGG 1 cut(s) 103
BsiHKAI GWGCWC 1 cut(s) 73
BslFI GGGAC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 2 cut(s) 22, 52
BspMAI CTGCAG 1 cut(s) 140
BspMI ACCTGC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 103
BssMI GATC 2 cut(s) 22, 52
BstAPI GCANNNNNTGC 1 cut(s) 144
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 2 cut(s) 25, 55
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 2 cut(s) 22, 52
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 136
BtsCI GGATG 1 cut(s) 49
BveI ACCTGC 1 cut(s) 138
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
DpnI GATC 2 cut(s) 24, 54
DpnII GATC 2 cut(s) 22, 52
FaiI YATR 3 cut(s) 108, 143, 145
FaqI GGGAC 1 cut(s) 116
FbaI TGATCA 2 cut(s) 22, 52
FokI GGATG 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 89
HpyCH4V TGCA 2 cut(s) 138, 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
Ksp22I TGATCA 2 cut(s) 22, 52
Kzo9I GATC 2 cut(s) 22, 52
LpnPI CCDG 2 cut(s) 84, 133
MalI GATC 2 cut(s) 24, 54
MboI GATC 2 cut(s) 22, 52
MboII GAAGA 1 cut(s) 73
MhlI GDGCHC 1 cut(s) 73
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 2 cut(s) 22, 52
PstI CTGCAG 1 cut(s) 140
Sau3AI GATC 2 cut(s) 22, 52
SduI GDGCHC 1 cut(s) 73
SetI ASST 2 cut(s) 80, 152
SfcI CTRYAG 1 cut(s) 136
SgeI CNNG 3 cut(s) 38, 68, 111
TspDTI ATGAA 1 cut(s) 73
TspGWI ACGGA 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.