Rh4AG417900

Thioredoxin domain-containing protein 9 homolog

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
71575905 .. 71577288
1384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG417900.1

Sequence Viewer

Length: 213 bp
ATGGAAATAATTGAGCAGCAAGTGTTGACGGTGGCGAAGACGGTGGAGGACAAGCTTGACGAGGAAATCGCAGCCCTAGATCGGCTAGACGACTACTATCTGGAGGTGCTTAGAGATCGAATGCTCCAGCAGATGAAGAAGATGGTGGAGAAGCACAGCCGTTGGATCTCCCTTGGCCACGACGAGTACACGAATTCGGACCCGGCACCATAA

Protein Analysis

70

Amino Acids

8.29

Weight (kDa)

4.61

Isoelectric Point (pI)

58.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 205
AclWI GGATC 1 cut(s) 173
AcoI YGGCCR 1 cut(s) 175
AcsI RAATTY 1 cut(s) 193
AfaI GTAC 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 81
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwI GGATC 1 cut(s) 173
AoxI GGCC 1 cut(s) 175
ApeKI GCWGC 2 cut(s) 16, 71
ApoI RAATTY 1 cut(s) 193
AspS9I GGNCC 1 cut(s) 199
AsuC2I CCSGG 1 cut(s) 203
AvaII GGWCC 1 cut(s) 199
BalI TGGCCA 1 cut(s) 177
BanI GGYRCC 1 cut(s) 205
BbsI GAAGAC 1 cut(s) 44
BbvI GCAGC 2 cut(s) 28, 83
BccI CCATC 1 cut(s) 136
BceAI ACGGC 1 cut(s) 144
BcnI CCSGG 1 cut(s) 203
BfaI CTAG 2 cut(s) 77, 86
BisI GCNGC 2 cut(s) 17, 72
BlsI GCNGC 2 cut(s) 18, 73
Bme1390I CCNGG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmiI GGNNCC 2 cut(s) 201, 207
BmrFI CCNGG 1 cut(s) 203
BpiI GAAGAC 1 cut(s) 44
BpmI CTGGAG 2 cut(s) 110, 122
BpuMI CCSGG 1 cut(s) 203
BsaJI CCNNGG 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 172
BseLI CCNNNNNNNGG 1 cut(s) 81
BseXI GCAGC 2 cut(s) 28, 83
BshFI GGCC 1 cut(s) 177
BshNI GGYRCC 1 cut(s) 205
BsiSI CCGG 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 81
BsmI GAATGC 1 cut(s) 126
BsnI GGCC 1 cut(s) 177
Bsp143I GATC 3 cut(s) 79, 115, 165
BspANI GGCC 1 cut(s) 177
BspLI GGNNCC 2 cut(s) 201, 207
BspPI GGATC 1 cut(s) 173
BspT107I GGYRCC 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 3 cut(s) 79, 115, 165
BssT1I CCWWGG 1 cut(s) 172
Bst4CI ACNGT 2 cut(s) 31, 43
BstDEI CTNAG 1 cut(s) 110
BstKTI GATC 3 cut(s) 82, 118, 168
BstMBI GATC 3 cut(s) 79, 115, 165
BstSCI CCNGG 1 cut(s) 201
BstV1I GCAGC 2 cut(s) 28, 83
BstV2I GAAGAC 1 cut(s) 44
BstX2I RGATCY 1 cut(s) 165
BstYI RGATCY 1 cut(s) 165
BsuRI GGCC 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 199
Csp6I GTAC 1 cut(s) 187
CviJI RGCY 5 cut(s) 55, 74, 85, 159, 177
CviKI_1 RGCY 5 cut(s) 55, 74, 85, 159, 177
CviQI GTAC 1 cut(s) 187
DdeI CTNAG 1 cut(s) 110
DpnI GATC 3 cut(s) 81, 117, 167
DpnII GATC 3 cut(s) 79, 115, 165
EaeI YGGCCR 1 cut(s) 175
Eco130I CCWWGG 1 cut(s) 172
Eco47I GGWCC 1 cut(s) 199
EcoRI GAATTC 1 cut(s) 193
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaiI YATR 1 cut(s) 211
Fnu4HI GCNGC 2 cut(s) 17, 72
Fsp4HI GCNGC 2 cut(s) 17, 72
FspBI CTAG 2 cut(s) 77, 86
GluI GCNGC 2 cut(s) 17, 72
GsuI CTGGAG 2 cut(s) 110, 122
HaeIII GGCC 1 cut(s) 177
HapII CCGG 1 cut(s) 203
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HindIII AAGCTT 1 cut(s) 53
HpaII CCGG 1 cut(s) 203
Hpy166II GTNNAC 2 cut(s) 27, 189
Hpy188I TCNGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 101
Hpy8I GTNNAC 2 cut(s) 27, 189
Hpy99I CGWCG 1 cut(s) 185
HpyCH4III ACNGT 2 cut(s) 31, 43
HpyF3I CTNAG 1 cut(s) 110
Kzo9I GATC 3 cut(s) 79, 115, 165
LmnI GCTCC 1 cut(s) 129
LpnPI CCDG 2 cut(s) 86, 140
Lsp1109I GCAGC 2 cut(s) 28, 83
MaeI CTAG 2 cut(s) 77, 86
MalI GATC 3 cut(s) 81, 117, 167
MboI GATC 3 cut(s) 79, 115, 165
MboII GAAGA 3 cut(s) 49, 148, 151
MflI RGATCY 1 cut(s) 165
MlsI TGGCCA 1 cut(s) 177
MluCI AATT 2 cut(s) 9, 193
MluNI TGGCCA 1 cut(s) 177
MmeI TCCRAC 1 cut(s) 143
MnlI CCTC 3 cut(s) 40, 55, 97
Mox20I TGGCCA 1 cut(s) 177
MscI TGGCCA 1 cut(s) 177
Msp20I TGGCCA 1 cut(s) 177
MspI CCGG 1 cut(s) 203
MspR9I CCNGG 1 cut(s) 203
Mva1269I GAATGC 1 cut(s) 126
NciI CCSGG 1 cut(s) 203
NdeII GATC 3 cut(s) 79, 115, 165
NlaIV GGNNCC 2 cut(s) 201, 207
PctI GAATGC 1 cut(s) 126
PkrI GCNGC 2 cut(s) 18, 73
PspN4I GGNNCC 2 cut(s) 201, 207
PspPI GGNCC 1 cut(s) 199
PsuI RGATCY 1 cut(s) 165
RsaI GTAC 1 cut(s) 188
RsaNI GTAC 1 cut(s) 187
SatI GCNGC 2 cut(s) 17, 72
Sau3AI GATC 3 cut(s) 79, 115, 165
Sau96I GGNCC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 203
SetI ASST 2 cut(s) 57, 108
SinI GGWCC 1 cut(s) 199
Sse9I AATT 2 cut(s) 9, 193
SspMI CTAG 2 cut(s) 77, 86
StyD4I CCNGG 1 cut(s) 201
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 2 cut(s) 31, 43
TaqI TCGA 1 cut(s) 118
TasI AATT 2 cut(s) 9, 193
TatI WGTACW 1 cut(s) 186
TseI GCWGC 2 cut(s) 16, 71
TspDTI ATGAA 1 cut(s) 149
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 193
XspI CTAG 2 cut(s) 77, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.