RchiOBHm_Chr6g0250031

Novel plant snare

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000840
Physical Location & Seq
Reverse (-)
5699897 .. 5702159
2263 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22414

Sequence Viewer

Length: 192 bp
ATGGCTCTCATGCATGTTATTGGAACTTCCTCTCAGCAACTTATTGATCATGGACACCAAATGATGGATGAGACTGATCAAGCGATTGATAGAGCACAAAGGTTCTTCATCAGACTATCAACTGAGGACTATGACTTTGAATGCTTTTGGGGTTTTCTACAGTATATGCAGGTTTTAAGTTCTGATTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec20

Protein Analysis

63

Amino Acids

7.48

Weight (kDa)

4.36

Isoelectric Point (pI)

49.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 160
AccB7I CCANNNNNTGG 1 cut(s) 64
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 1 cut(s) 140
Alw21I GWGCWC 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 65
ArsI GACNNNNNNTTYG 2 cut(s) 119, 151
Bbv12I GWGCWC 1 cut(s) 97
BccI CCATC 1 cut(s) 58
BclI TGATCA 2 cut(s) 46, 76
BcoDI GTCTC 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 158
BfuAI ACCTGC 1 cut(s) 160
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 2 cut(s) 47, 114
BsiHKAI GWGCWC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 65
BsmI GAATGC 1 cut(s) 146
Bsp1286I GDGCHC 1 cut(s) 97
Bsp143I GATC 2 cut(s) 46, 76
BspCNI CTCAG 2 cut(s) 46, 115
BspMI ACCTGC 1 cut(s) 160
BssMI GATC 2 cut(s) 46, 76
Bst4CI ACNGT 1 cut(s) 162
BstDEI CTNAG 2 cut(s) 33, 123
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 49, 79
BstMAI GTCTC 1 cut(s) 65
BstMBI GATC 2 cut(s) 46, 76
BstNSI RCATGY 1 cut(s) 17
BstSFI CTRYAG 1 cut(s) 158
BtsCI GGATG 1 cut(s) 73
BveI ACCTGC 1 cut(s) 160
CviAII CATG 3 cut(s) 10, 14, 50
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 2 cut(s) 33, 123
DpnI GATC 2 cut(s) 48, 78
DpnII GATC 2 cut(s) 46, 76
EcoT22I ATGCAT 1 cut(s) 15
FaeI CATG 3 cut(s) 13, 17, 53
FaiI YATR 6 cut(s) 11, 15, 51, 132, 165, 167
FatI CATG 3 cut(s) 9, 13, 49
FbaI TGATCA 2 cut(s) 46, 76
FokI GGATG 1 cut(s) 80
Hin1II CATG 3 cut(s) 13, 17, 53
Hpy188I TCNGA 2 cut(s) 113, 184
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4V TGCA 2 cut(s) 13, 169
HpyF3I CTNAG 2 cut(s) 33, 123
Hsp92II CATG 3 cut(s) 13, 17, 53
Ksp22I TGATCA 2 cut(s) 46, 76
Kzo9I GATC 2 cut(s) 46, 76
LpnPI CCDG 1 cut(s) 155
MalI GATC 2 cut(s) 48, 78
MboI GATC 2 cut(s) 46, 76
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 1 cut(s) 97
MnlI CCTC 2 cut(s) 40, 118
Mph1103I ATGCAT 1 cut(s) 15
MseI TTAA 1 cut(s) 176
Mva1269I GAATGC 1 cut(s) 146
NdeII GATC 2 cut(s) 46, 76
NlaIII CATG 3 cut(s) 13, 17, 53
NsiI ATGCAT 1 cut(s) 15
NspI RCATGY 1 cut(s) 17
PctI GAATGC 1 cut(s) 146
PflMI CCANNNNNTGG 1 cut(s) 64
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 2 cut(s) 46, 76
SduI GDGCHC 1 cut(s) 97
SetI ASST 2 cut(s) 104, 174
SfcI CTRYAG 1 cut(s) 158
SgeI CNNG 5 cut(s) 22, 26, 62, 92, 182
TaaI ACNGT 1 cut(s) 162
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TspDTI ATGAA 1 cut(s) 97
Van91I CCANNNNNTGG 1 cut(s) 64
XceI RCATGY 1 cut(s) 17
Zsp2I ATGCAT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.