Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0036490.1

Orthogroup ID

OG0000840

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 425

Gene Structure 425 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0036490.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 211 bp

atgttgtcctgcagtgcaaatcgcggggatagtttggacatagccattgacaatgaaaacaggcagaccaaagacttccttattctggatacccatctggaggcacctgaagagttctcgaagaaggctaaactgttcttcgctcatggtgctgataaatgggatgctgagttttatgccaaagtcaatgatgatgtttatgtaaatattg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0006029 GO:0006464 GO:0006486 GO:0006493 GO:0006807 GO:0008150 GO:0008152 GO:0008378 GO:0009058 GO:0009059 GO:0009100 GO:0009101 GO:0009987 GO:0010384 GO:0010404 GO:0010405 GO:0012505 GO:0016740 GO:0016757 GO:0016758 GO:0018193 GO:0018208 GO:0018258 GO:0019538 GO:0031410 GO:0031982 GO:0031984 GO:0034645 GO:0036211 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043413 GO:0044036 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0070085 GO:0071554 GO:0071704 GO:0097708 GO:0098791 GO:1901135 GO:1901137 GO:1901564 GO:1901566 GO:1901576 GO:1990714

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4094 Galactosyl_T

Protein Analysis

70

Amino Acids

8.0

Weight (kDa)

4.61

Isoelectric Point (pI)

32.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000840)

Species	Orthologous Gene IDs
malus_domestica	MD03G1055300.v1.1 MD07G1214200.v1.1 MD12G1168400.v1.1
pyrus_communis	pycom04g07310 pycom12g15990
rosa_chinensis	RchiOBHm_Chr1g0313541 RchiOBHm_Chr1g0317181 RchiOBHm_Chr2g0134361 RchiOBHm_Chr6g0250031
rosa_laevigata	RLG00000003886 RLG00000007406 RLG00000011469 RLG00000011470 RLG00000030498 RLG00000033863
rosa_multiflora	Rmu_sc0002892.1_g000017 Rmu_sc0003338.1_g000013 Rmu_sc0004498.1_g000009 Rmu_sc0006199.1_g000003 Rmu_sc0016218.1_g000011 Rmu_sc0016786.1_g000001 Rmu_sc0036490.1_g000001
rosa_roxburghii	Rroxscaffold_1G00042920 Rroxscaffold_2G00082220 Rroxscaffold_2G00114810 Rroxscaffold_3G00220570 Rroxscaffold_3G00228270 Rroxscaffold_3G00236760 Rroxscaffold_3G00240020 Rroxscaffold_3G00250010 Rroxscaffold_3G00257960 Rroxscaffold_5G00352750 Rroxscaffold_5G00379700 Rroxscaffold_6G00388200
rosa_rugosa	Rorug01G0066800 Rorug05G0244200 Rorug06G0061500 Rorug06G0061600 Rorug06G0061600 Rorug06G0061700 Rorug06G0111400 Rorug06G0489100
rosa_samantha	Rh1AG003800 Rh1AG038900 Rh1AG416400 Rh1BG321500 Rh1CG067300 Rh1DG072100 Rh1DG153100 Rh1DG360700 Rh2AG053000 Rh2BG375000 Rh2CG492900 Rh2DG220300 Rh3BG324200 Rh3CG298300 Rh4AG417900 Rh4CG444400 Rh4DG158900 Rh4DG425600 Rh5DG417100 Rh6AG252400 Rh7AG428200 Rh7BG192200 Rh7CG178900 Rh7DG171700 Rh7DG435000
rosa_wichuraiana	Rw6G007890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	103
AccII	CGCG	1 cut(s)	24
AciI	CCGC	1 cut(s)	24
AcuI	CTGAAG	1 cut(s)	129
AfiI	CCNNNNNNNGG	2 cut(s)	85, 100
BanI	GGYRCC	1 cut(s)	103
BccI	CCATC	1 cut(s)	102
BciVI	GTATCC	1 cut(s)	82
BfmI	CTRYAG	1 cut(s)	10
BfuI	GTATCC	1 cut(s)	82
BmiI	GGNNCC	1 cut(s)	105
BmsI	GCATC	1 cut(s)	154
BpmI	CTGGAG	1 cut(s)	119
BsaBI	GATNNNNATC	1 cut(s)	93
Bsc4I	CCNNNNNNNGG	2 cut(s)	85, 100
Bse8I	GATNNNNATC	1 cut(s)	93
BseGI	GGATG	1 cut(s)	169
BseJI	GATNNNNATC	1 cut(s)	93
BseLI	CCNNNNNNNGG	2 cut(s)	85, 100
BseMII	CTCAG	1 cut(s)	159
Bsh1236I	CGCG	1 cut(s)	24
BshNI	GGYRCC	1 cut(s)	103
BslI	CCNNNNNNNGG	2 cut(s)	85, 100
BspACI	CCGC	1 cut(s)	24
BspCNI	CTCAG	1 cut(s)	160
BspFNI	CGCG	1 cut(s)	24
BspLI	GGNNCC	1 cut(s)	105
BspMAI	CTGCAG	1 cut(s)	14
BspT107I	GGYRCC	1 cut(s)	103
Bst4CI	ACNGT	1 cut(s)	135
Bst6I	CTCTTC	1 cut(s)	105
BstDEI	CTNAG	1 cut(s)	168
BstF5I	GGATG	1 cut(s)	169
BstFNI	CGCG	1 cut(s)	24
BstMWI	GCNNNNNNNGC	1 cut(s)	149
BstSFI	CTRYAG	1 cut(s)	10
BstUI	CGCG	1 cut(s)	24
BsuI	GTATCC	1 cut(s)	82
BtsCI	GGATG	1 cut(s)	169
BtsI	GCAGTG	1 cut(s)	19
BtsIMutI	CAGTG	1 cut(s)	19
CviAII	CATG	1 cut(s)	146
CviJI	RGCY	2 cut(s)	44, 128
CviKI_1	RGCY	2 cut(s)	44, 128
DdeI	CTNAG	1 cut(s)	168
Eam1104I	CTCTTC	1 cut(s)	105
EarI	CTCTTC	1 cut(s)	105
Eco57I	CTGAAG	1 cut(s)	129
FaeI	CATG	1 cut(s)	149
FaiI	YATR	4 cut(s)	41, 147, 177, 201
FalI	AAGNNNNNCTT	2 cut(s)	63, 95
FatI	CATG	1 cut(s)	145
FauI	CCCGC	1 cut(s)	17
FokI	GGATG	1 cut(s)	176
GsuI	CTGGAG	1 cut(s)	119
Hin1II	CATG	1 cut(s)	149
Hpy188III	TCNNGA	3 cut(s)	86, 98, 118
HpyAV	CCTTC	1 cut(s)	118
HpyCH4III	ACNGT	1 cut(s)	135
HpyCH4V	TGCA	2 cut(s)	12, 17
HpyF10VI	GCNNNNNNNGC	1 cut(s)	149
HpyF3I	CTNAG	1 cut(s)	168
Hsp92II	CATG	1 cut(s)	149
LpnPI	CCDG	5 cut(s)	22, 46, 71, 83, 120
LweI	GCATC	1 cut(s)	154
MboII	GAAGA	3 cut(s)	122, 130, 133
MnlI	CCTC	1 cut(s)	94
MvnI	CGCG	1 cut(s)	24
MwoI	GCNNNNNNNGC	1 cut(s)	149
NlaIII	CATG	1 cut(s)	149
NlaIV	GGNNCC	1 cut(s)	105
PspN4I	GGNNCC	1 cut(s)	105
PstI	CTGCAG	1 cut(s)	14
SetI	ASST	1 cut(s)	109
SfaNI	GCATC	1 cut(s)	154
SfcI	CTRYAG	1 cut(s)	10
SgeI	CNNG	9 cut(s)	21, 35, 37, 73, 98, 110, 119, 130, 158
SsiI	CCGC	1 cut(s)	24
SspI	AATATT	1 cut(s)	208
TaaI	ACNGT	1 cut(s)	135
TaqI	TCGA	1 cut(s)	119
TscAI	CASTG	1 cut(s)	19
TspDTI	ATGAA	1 cut(s)	69
TspRI	CASTG	1 cut(s)	19

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.