Rroxscaffold_2G00114810

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000840
Physical Location & Seq
Reverse (-)
40915103 .. 40923052
7950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00114810.1

Sequence Viewer

Length: 195 bp
ATGGAAAATGAACAAGCAATAATAATTGAGCAGAAAGTGTTGACGGTGGAGGACAAGCTCGACGAGGAAATCACAGCCCTAGATTGGTTGGATGATGACGATCCGGAGATGATGGGTGTTTTGCTTAGAGATTTGAAGCTTGGAGATGATGGTGTTTTGCTTCACATTGATTTGGTTGCAGAAAGCGGCGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.19

Weight (kDa)

4.05

Isoelectric Point (pI)

44.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 103
AciI CCGC 1 cut(s) 186
AclWI GGATC 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 84
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 2 cut(s) 58, 139
AluI AGCT 2 cut(s) 58, 139
AlwI GGATC 1 cut(s) 95
Aor13HI TCCGGA 1 cut(s) 103
BccI CCATC 2 cut(s) 106, 143
BfaI CTAG 1 cut(s) 80
BisI GCNGC 1 cut(s) 187
BlsI GCNGC 1 cut(s) 188
BsaBI GATNNNNATC 1 cut(s) 99
BsaWI WCCGGW 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 84
Bse8I GATNNNNATC 1 cut(s) 99
BseAI TCCGGA 1 cut(s) 103
BseGI GGATG 1 cut(s) 97
BseJI GATNNNNATC 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 84
BsiSI CCGG 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 84
Bsp13I TCCGGA 1 cut(s) 103
Bsp143I GATC 1 cut(s) 100
BspACI CCGC 1 cut(s) 186
BspEI TCCGGA 1 cut(s) 103
BspPI GGATC 1 cut(s) 95
BssMI GATC 1 cut(s) 100
Bst4CI ACNGT 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 97
BstKTI GATC 1 cut(s) 103
BstMBI GATC 1 cut(s) 100
BtsCI GGATG 1 cut(s) 97
CviJI RGCY 3 cut(s) 58, 77, 139
CviKI_1 RGCY 3 cut(s) 58, 77, 139
DdeI CTNAG 1 cut(s) 125
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Fnu4HI GCNGC 1 cut(s) 187
FokI GGATG 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 187
FspBI CTAG 1 cut(s) 80
GluI GCNGC 1 cut(s) 187
HapII CCGG 1 cut(s) 104
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HindIII AAGCTT 1 cut(s) 137
HpaII CCGG 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 42
Hpy99I CGWCG 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 125
Kpn2I TCCGGA 1 cut(s) 103
Kzo9I GATC 1 cut(s) 100
LpnPI CCDG 1 cut(s) 117
MaeI CTAG 1 cut(s) 80
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MluCI AATT 1 cut(s) 24
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 2 cut(s) 43, 58
MroI TCCGGA 1 cut(s) 103
MspI CCGG 1 cut(s) 104
NdeII GATC 1 cut(s) 100
PkrI GCNGC 1 cut(s) 188
SatI GCNGC 1 cut(s) 187
Sau3AI GATC 1 cut(s) 100
SetI ASST 2 cut(s) 60, 141
SgeI CNNG 7 cut(s) 26, 67, 71, 76, 92, 116, 152
Sse9I AATT 1 cut(s) 24
SsiI CCGC 1 cut(s) 186
SspMI CTAG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 46
TaqI TCGA 1 cut(s) 60
TasI AATT 1 cut(s) 24
TauI GCSGC 1 cut(s) 189
TspDTI ATGAA 1 cut(s) 24
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.