Rroxscaffold_3G00220570

Novel plant snare

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000840
Physical Location & Seq
Forward (+)
2888872 .. 2893940
5069 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00220570.1

Sequence Viewer

Length: 168 bp
ATGACAAATCAGCAACTTATTGATCATGGACACCAAATGATGGATGAGACTGATCAAGCGATTGATAGAACACAAAAGTTCTTCATCAGCCTATCAACTGAGGACTATGACTTTGAATGCTTTTGGGGTTTTCTGCAGTATATGCAGGTTTTAAGTTCTGATTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Sec20

Protein Analysis

55

Amino Acids

6.63

Weight (kDa)

4.05

Isoelectric Point (pI)

31.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 136
AccB7I CCANNNNNTGG 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 41
ArsI GACNNNNNNTTYG 2 cut(s) 95, 127
BccI CCATC 1 cut(s) 34
BclI TGATCA 2 cut(s) 22, 52
BcoDI GTCTC 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 134
BfuAI ACCTGC 1 cut(s) 136
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseGI GGATG 1 cut(s) 49
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 41
BsmI GAATGC 1 cut(s) 122
Bsp143I GATC 2 cut(s) 22, 52
BspCNI CTCAG 1 cut(s) 91
BspMAI CTGCAG 1 cut(s) 138
BspMI ACCTGC 1 cut(s) 136
BssMI GATC 2 cut(s) 22, 52
BstAPI GCANNNNNTGC 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 2 cut(s) 25, 55
BstMAI GTCTC 1 cut(s) 41
BstMBI GATC 2 cut(s) 22, 52
BstMWI GCNNNNNNNGC 1 cut(s) 142
BstSFI CTRYAG 1 cut(s) 134
BtsCI GGATG 1 cut(s) 49
BveI ACCTGC 1 cut(s) 136
CviAII CATG 1 cut(s) 26
CviJI RGCY 1 cut(s) 90
CviKI_1 RGCY 1 cut(s) 90
DdeI CTNAG 1 cut(s) 99
DpnI GATC 2 cut(s) 24, 54
DpnII GATC 2 cut(s) 22, 52
FaeI CATG 1 cut(s) 29
FaiI YATR 4 cut(s) 27, 108, 141, 143
FatI CATG 1 cut(s) 25
FbaI TGATCA 2 cut(s) 22, 52
FokI GGATG 1 cut(s) 56
FspEI CC 9 cut(s) 12, 26, 47, 86, 104, 109, 110, 111, 131
Hin1II CATG 1 cut(s) 29
Hpy188I TCNGA 1 cut(s) 160
HpyCH4V TGCA 2 cut(s) 136, 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 1 cut(s) 29
Ksp22I TGATCA 2 cut(s) 22, 52
Kzo9I GATC 2 cut(s) 22, 52
LpnPI CCDG 1 cut(s) 131
MalI GATC 2 cut(s) 24, 54
MboI GATC 2 cut(s) 22, 52
MboII GAAGA 1 cut(s) 73
MnlI CCTC 1 cut(s) 94
MseI TTAA 1 cut(s) 152
Mva1269I GAATGC 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 142
NdeII GATC 2 cut(s) 22, 52
NlaIII CATG 1 cut(s) 29
PctI GAATGC 1 cut(s) 122
PflMI CCANNNNNTGG 1 cut(s) 40
PstI CTGCAG 1 cut(s) 138
SaqAI TTAA 1 cut(s) 152
Sau3AI GATC 2 cut(s) 22, 52
SetI ASST 1 cut(s) 150
SfcI CTRYAG 1 cut(s) 134
SgeI CNNG 3 cut(s) 38, 68, 158
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
TspDTI ATGAA 1 cut(s) 73
Van91I CCANNNNNTGG 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.