Rmu_sc0016218.1_g000011

Thioredoxin domain-containing protein 9 homolog

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016218.1
Physical Location & Seq
Forward (+)
48460 .. 48824
365 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016218.1_g000011.1.cds

Sequence Viewer

Length: 273 bp
atggcgaaccgagcagtccaagagataattgagcagcaactgctaacggtggcgaaggtagtggaggacaagctcgacgaggagatcgcagccctagatctagtggacgacaacgatctggaggtgctcagagagcgaaggctccagcaaatgaagaagatggaggagaagcacagccgttggatctcccttggccacgacaagtacatggagatcctttctgagaagaaagacaaaagccatgaccaaaaaatcgttagaaagctatggtga

Protein Analysis

90

Amino Acids

10.77

Weight (kDa)

5.62

Isoelectric Point (pI)

67.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 191, 208
AcoI YGGCCR 1 cut(s) 193
AfaI GTAC 1 cut(s) 206
AluBI AGCT 2 cut(s) 73, 265
AluI AGCT 2 cut(s) 73, 265
Alw21I GWGCWC 1 cut(s) 129
AlwI GGATC 2 cut(s) 191, 208
AlwNI CAGNNNCTG 1 cut(s) 40
AoxI GGCC 1 cut(s) 193
ApeKI GCWGC 2 cut(s) 34, 89
BalI TGGCCA 1 cut(s) 195
Bbv12I GWGCWC 1 cut(s) 129
BbvI GCAGC 2 cut(s) 46, 101
BccI CCATC 1 cut(s) 154
BceAI ACGGC 1 cut(s) 162
BfaI CTAG 2 cut(s) 95, 101
BglII AGATCT 1 cut(s) 97
BisI GCNGC 2 cut(s) 35, 90
BlsI GCNGC 2 cut(s) 36, 91
BmiI GGNNCC 1 cut(s) 143
BpmI CTGGAG 2 cut(s) 128, 140
BsaJI CCNNGG 1 cut(s) 190
BseDI CCNNGG 1 cut(s) 190
BseMII CTCAG 2 cut(s) 142, 213
BseRI GAGGAG 2 cut(s) 95, 179
BseXI GCAGC 2 cut(s) 46, 101
BshFI GGCC 1 cut(s) 195
BsiHKAI GWGCWC 1 cut(s) 129
BsnI GGCC 1 cut(s) 195
Bsp1286I GDGCHC 1 cut(s) 129
Bsp143I GATC 5 cut(s) 84, 97, 115, 183, 213
BspANI GGCC 1 cut(s) 195
BspCNI CTCAG 2 cut(s) 141, 214
BspLI GGNNCC 1 cut(s) 143
BspPI GGATC 2 cut(s) 191, 208
BssECI CCNNGG 1 cut(s) 190
BssMI GATC 5 cut(s) 84, 97, 115, 183, 213
BssT1I CCWWGG 1 cut(s) 190
Bst4CI ACNGT 1 cut(s) 49
BstAPI GCANNNNNTGC 1 cut(s) 40
BstDEI CTNAG 2 cut(s) 128, 222
BstKTI GATC 5 cut(s) 87, 100, 118, 186, 216
BstMBI GATC 5 cut(s) 84, 97, 115, 183, 213
BstMWI GCNNNNNNNGC 3 cut(s) 11, 40, 133
BstV1I GCAGC 2 cut(s) 46, 101
BstX2I RGATCY 3 cut(s) 97, 183, 213
BstYI RGATCY 3 cut(s) 97, 183, 213
BsuRI GGCC 1 cut(s) 195
CaiI CAGNNNCTG 1 cut(s) 40
Csp6I GTAC 1 cut(s) 205
CviAII CATG 2 cut(s) 208, 242
CviJI RGCY 7 cut(s) 73, 92, 142, 177, 195, 240, 265
CviKI_1 RGCY 7 cut(s) 73, 92, 142, 177, 195, 240, 265
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 2 cut(s) 128, 222
DpnI GATC 5 cut(s) 86, 99, 117, 185, 215
DpnII GATC 5 cut(s) 84, 97, 115, 183, 213
EaeI YGGCCR 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 190
ErhI CCWWGG 1 cut(s) 190
FaeI CATG 2 cut(s) 211, 245
FaiI YATR 3 cut(s) 209, 243, 268
FatI CATG 2 cut(s) 207, 241
Fnu4HI GCNGC 2 cut(s) 35, 90
Fsp4HI GCNGC 2 cut(s) 35, 90
FspBI CTAG 2 cut(s) 95, 101
GluI GCNGC 2 cut(s) 35, 90
GsuI CTGGAG 2 cut(s) 128, 140
HaeIII GGCC 1 cut(s) 195
Hin1II CATG 2 cut(s) 211, 245
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 131, 223
Hpy188III TCNNGA 1 cut(s) 119
Hpy8I GTNNAC 1 cut(s) 106
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 2 cut(s) 49, 132
HpyCH4III ACNGT 1 cut(s) 49
HpyF10VI GCNNNNNNNGC 3 cut(s) 11, 40, 133
HpyF3I CTNAG 2 cut(s) 128, 222
Hsp92II CATG 2 cut(s) 211, 245
Kzo9I GATC 5 cut(s) 84, 97, 115, 183, 213
LmnI GCTCC 1 cut(s) 147
LpnPI CCDG 2 cut(s) 104, 158
Lsp1109I GCAGC 2 cut(s) 46, 101
MaeI CTAG 2 cut(s) 95, 101
MalI GATC 5 cut(s) 86, 99, 117, 185, 215
MboI GATC 5 cut(s) 84, 97, 115, 183, 213
MboII GAAGA 3 cut(s) 166, 169, 238
MflI RGATCY 3 cut(s) 97, 183, 213
MhlI GDGCHC 1 cut(s) 129
MlsI TGGCCA 1 cut(s) 195
MluCI AATT 1 cut(s) 27
MluNI TGGCCA 1 cut(s) 195
MmeI TCCRAC 1 cut(s) 161
MnlI CCTC 4 cut(s) 58, 73, 115, 157
Mox20I TGGCCA 1 cut(s) 195
MscI TGGCCA 1 cut(s) 195
Msp20I TGGCCA 1 cut(s) 195
MwoI GCNNNNNNNGC 3 cut(s) 11, 40, 133
NdeII GATC 5 cut(s) 84, 97, 115, 183, 213
NlaIII CATG 2 cut(s) 211, 245
NlaIV GGNNCC 1 cut(s) 143
PkrI GCNGC 2 cut(s) 36, 91
PspN4I GGNNCC 1 cut(s) 143
PstNI CAGNNNCTG 1 cut(s) 40
PsuI RGATCY 3 cut(s) 97, 183, 213
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SatI GCNGC 2 cut(s) 35, 90
Sau3AI GATC 5 cut(s) 84, 97, 115, 183, 213
SduI GDGCHC 1 cut(s) 129
SetI ASST 4 cut(s) 60, 75, 126, 267
Sse9I AATT 1 cut(s) 27
SspMI CTAG 2 cut(s) 95, 101
StyI CCWWGG 1 cut(s) 190
TaaI ACNGT 1 cut(s) 49
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 27
TatI WGTACW 1 cut(s) 204
TseI GCWGC 2 cut(s) 34, 89
TspDTI ATGAA 1 cut(s) 167
XspI CTAG 2 cut(s) 95, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.