RchiOBHm_Chr1g0320671

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
8279405 .. 8279709
305 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55080

Sequence Viewer

Length: 216 bp
ATGAGAGAGAGCGACAGAGGAAGCGTGTGTTTGCTTGCTTTGCACGAAGAGATAGACAGATCAGTTGTTGTGCGATTGACAAGTTTGGGTATAATTCTGGGTTCTTCTTCTTTTTGGACGGACTATGGTGTTCTGATTTCTGGTTTTGGTGGGTTTGGCGAGAGAGAGGATCGCAGGGCTTTTGTTTGTCTTTGGATTTGGGAGTTCGGTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.01

Weight (kDa)

4.78

Isoelectric Point (pI)

44.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 177
AlwI GGATC 1 cut(s) 177
Bsp143I GATC 2 cut(s) 59, 169
BspPI GGATC 1 cut(s) 177
BssMI GATC 2 cut(s) 59, 169
Bst6I CTCTTC 1 cut(s) 42
BstC8I GCNNGC 1 cut(s) 36
BstKTI GATC 2 cut(s) 62, 172
BstMBI GATC 2 cut(s) 59, 169
BstMWI GCNNNNNNNGC 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 36
CviJI RGCY 1 cut(s) 179
CviKI_1 RGCY 1 cut(s) 179
DpnI GATC 2 cut(s) 61, 171
DpnII GATC 2 cut(s) 59, 169
Eam1104I CTCTTC 1 cut(s) 42
EarI CTCTTC 1 cut(s) 42
FaiI YATR 2 cut(s) 92, 126
Hpy188I TCNGA 1 cut(s) 135
HpyCH4V TGCA 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
Kzo9I GATC 2 cut(s) 59, 169
LpnPI CCDG 3 cut(s) 83, 126, 160
MalI GATC 2 cut(s) 61, 171
MboI GATC 2 cut(s) 59, 169
MboII GAAGA 3 cut(s) 59, 96, 99
MluCI AATT 1 cut(s) 93
MnlI CCTC 2 cut(s) 11, 160
MwoI GCNNNNNNNGC 1 cut(s) 40
NdeII GATC 2 cut(s) 59, 169
Sau3AI GATC 2 cut(s) 59, 169
SgeI CNNG 8 cut(s) 37, 47, 56, 93, 110, 153, 172, 187
Sse9I AATT 1 cut(s) 93
TasI AATT 1 cut(s) 93
TspGWI ACGGA 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.