Rh5DG489000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
76829479 .. 76831630
2152 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG489000.1

Sequence Viewer

Length: 201 bp
ATGGAGGCCATGGACATCATCTCAAGGGAGGCGATTCACGGCGTGAGGTGGGTTTCGGCGGCGGGGATGGCTACTTTGGGGGGAGCTGGTAGCGGCTTGAGACAGCGATCCAAGTTTGGCTGGCTTGCTCAGTCTTCATCGGTGCTTTCTGGTGATCGTTCCTTCAGGCGTCGTGGCCCTGGCTTGCTTGCGGAGGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.97

Weight (kDa)

11.53

Isoelectric Point (pI)

73.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 59, 62, 93, 191
AclWI GGATC 1 cut(s) 102
AcuI CTGAAG 1 cut(s) 148
AcyI GRCGYC 1 cut(s) 169
AdeI CACNNNGTG 1 cut(s) 43
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 94
AlwI GGATC 1 cut(s) 102
AoxI GGCC 2 cut(s) 6, 175
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 164
BbsI GAAGAC 1 cut(s) 126
BccI CCATC 1 cut(s) 61
BceAI ACGGC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 180
BcoDI GTCTC 1 cut(s) 94
BisI GCNGC 2 cut(s) 60, 94
BlsI GCNGC 2 cut(s) 61, 95
Bme1390I CCNGG 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 176
BmrFI CCNGG 1 cut(s) 180
BpiI GAAGAC 1 cut(s) 126
BpuEI CTTGAG 2 cut(s) 7, 118
BsaHI GRCGYC 1 cut(s) 169
BsaJI CCNNGG 2 cut(s) 9, 178
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 2 cut(s) 9, 178
BseGI GGATG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 143
BshFI GGCC 2 cut(s) 8, 177
BsmAI GTCTC 1 cut(s) 94
BsnI GGCC 2 cut(s) 8, 177
Bsp143I GATC 2 cut(s) 107, 154
Bsp19I CCATGG 1 cut(s) 9
BspACI CCGC 4 cut(s) 59, 62, 93, 191
BspANI GGCC 2 cut(s) 8, 177
BspCNI CTCAG 1 cut(s) 142
BspPI GGATC 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 9, 178
BssMI GATC 2 cut(s) 107, 154
BssNI GRCGYC 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 180
BstACI GRCGYC 1 cut(s) 169
BstC8I GCNNGC 4 cut(s) 122, 126, 185, 189
BstDEI CTNAG 1 cut(s) 129
BstDSI CCRYGG 1 cut(s) 9
BstF5I GGATG 1 cut(s) 72
BstKTI GATC 2 cut(s) 110, 157
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 2 cut(s) 107, 154
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstV2I GAAGAC 1 cut(s) 126
BsuRI GGCC 2 cut(s) 8, 177
BtgI CCRYGG 1 cut(s) 9
BtsCI GGATG 1 cut(s) 72
Cac8I GCNNGC 4 cut(s) 122, 126, 185, 189
Cfr13I GGNCC 1 cut(s) 176
CseI GACGC 1 cut(s) 158
CviAII CATG 1 cut(s) 10
CviJI RGCY 8 cut(s) 8, 71, 86, 96, 120, 124, 177, 183
CviKI_1 RGCY 8 cut(s) 8, 71, 86, 96, 120, 124, 177, 183
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 109, 156
DpnII GATC 2 cut(s) 107, 154
DraIII CACNNNGTG 1 cut(s) 43
Eco130I CCWWGG 1 cut(s) 9
Eco57I CTGAAG 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 1 cut(s) 13
FaiI YATR 1 cut(s) 11
FatI CATG 1 cut(s) 9
FauI CCCGC 1 cut(s) 55
Fnu4HI GCNGC 2 cut(s) 60, 94
FokI GGATG 1 cut(s) 79
Fsp4HI GCNGC 2 cut(s) 60, 94
GluI GCNGC 2 cut(s) 60, 94
HaeIII GGCC 2 cut(s) 8, 177
HgaI GACGC 1 cut(s) 158
Hin1I GRCGYC 1 cut(s) 169
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 34
HphI GGTGA 1 cut(s) 164
Hpy99I CGWCG 1 cut(s) 174
HpyAV CCTTC 1 cut(s) 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 129
Hsp92I GRCGYC 1 cut(s) 169
Hsp92II CATG 1 cut(s) 13
Kzo9I GATC 2 cut(s) 107, 154
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 6 cut(s) 72, 106, 135, 151, 165, 192
MalI GATC 2 cut(s) 109, 156
MboI GATC 2 cut(s) 107, 154
MboII GAAGA 1 cut(s) 126
MnlI CCTC 3 cut(s) 22, 39, 187
MspR9I CCNGG 1 cut(s) 180
MvaI CCWGG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 68
NcoI CCATGG 1 cut(s) 9
NdeII GATC 2 cut(s) 107, 154
NlaIII CATG 1 cut(s) 13
PfeI GAWTC 1 cut(s) 34
PkrI GCNGC 2 cut(s) 61, 95
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspPI GGNCC 1 cut(s) 176
SatI GCNGC 2 cut(s) 60, 94
Sau3AI GATC 2 cut(s) 107, 154
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 180
SetI ASST 2 cut(s) 50, 88
SmlI CTYRAG 2 cut(s) 22, 97
SmoI CTYRAG 2 cut(s) 22, 97
SsiI CCGC 4 cut(s) 59, 62, 93, 191
StyD4I CCNGG 1 cut(s) 178
StyI CCWWGG 1 cut(s) 9
TauI GCSGC 2 cut(s) 62, 96
TfiI GAWTC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.