Rmu_sc0002312.1_g000067

RNA polymerase sigma factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002312.1
Physical Location & Seq
Reverse (-)
287920 .. 289038
1119 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002312.1_g000067.1.cds

Sequence Viewer

Length: 240 bp
atggtcaacaacttgggtgtttcaagagcactggttgaaatttccagaaccttcctactgcctacacatttgcatgagaggttagggttactcaaaaatgcaagagttagattggaagagaaacgaataactccatctatcgataggattgcagaaagcctgaatatgtccaaaaagaaagttaggaagttactcaggtatcaagtgctcgaaaaaccaagagaggccaacaccttatga

Protein Analysis

79

Amino Acids

9.2

Weight (kDa)

10.95

Isoelectric Point (pI)

33.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AgsI TTSAA 2 cut(s) 24, 38
Alw21I GWGCWC 2 cut(s) 31, 210
AoxI GGCC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 39
BaeI ACNNNNGTAYC 2 cut(s) 182, 215
Bbv12I GWGCWC 2 cut(s) 31, 210
BccI CCATC 1 cut(s) 142
BcgI CGANNNNNNTGC 2 cut(s) 131, 165
Bsa29I ATCGAT 1 cut(s) 141
Bse1I ACTGG 1 cut(s) 36
BseCI ATCGAT 1 cut(s) 141
BseMII CTCAG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 36
BshFI GGCC 1 cut(s) 227
BshVI ATCGAT 1 cut(s) 141
BsiHKAI GWGCWC 2 cut(s) 31, 210
BsnI GGCC 1 cut(s) 227
Bsp1286I GDGCHC 2 cut(s) 31, 210
BspANI GGCC 1 cut(s) 227
BspCNI CTCAG 1 cut(s) 207
BspDI ATCGAT 1 cut(s) 141
BsrI ACTGG 1 cut(s) 36
Bst6I CTCTTC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 194
Bsu15I ATCGAT 1 cut(s) 141
BsuRI GGCC 1 cut(s) 227
BsuTUI ATCGAT 1 cut(s) 141
BtsIMutI CAGTG 1 cut(s) 29
ClaI ATCGAT 1 cut(s) 141
CviAII CATG 1 cut(s) 74
CviJI RGCY 2 cut(s) 159, 227
CviKI_1 RGCY 2 cut(s) 159, 227
DdeI CTNAG 1 cut(s) 194
Eam1104I CTCTTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 111
FaeI CATG 1 cut(s) 77
FaiI YATR 3 cut(s) 75, 167, 238
FatI CATG 1 cut(s) 73
HaeIII GGCC 1 cut(s) 227
Hin1II CATG 1 cut(s) 77
HincII GTYRAC 1 cut(s) 7
HindII GTYRAC 1 cut(s) 7
Hpy166II GTNNAC 1 cut(s) 7
Hpy188III TCNNGA 2 cut(s) 24, 45
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 3 cut(s) 73, 101, 152
HpyF3I CTNAG 1 cut(s) 194
Hsp92II CATG 1 cut(s) 77
LpnPI CCDG 4 cut(s) 17, 58, 173, 181
MaeIII GTNAC 2 cut(s) 87, 189
MboII GAAGA 1 cut(s) 128
MhlI GDGCHC 2 cut(s) 31, 210
MluCI AATT 1 cut(s) 39
MnlI CCTC 2 cut(s) 72, 217
MslI CAYNNNNRTG 1 cut(s) 72
NlaIII CATG 1 cut(s) 77
RseI CAYNNNNRTG 1 cut(s) 72
SduI GDGCHC 2 cut(s) 31, 210
SetI ASST 4 cut(s) 53, 83, 200, 236
SmiMI CAYNNNNRTG 1 cut(s) 72
Sse9I AATT 1 cut(s) 39
TaqI TCGA 2 cut(s) 141, 210
TasI AATT 1 cut(s) 39
TscAI CASTG 1 cut(s) 36
TspRI CASTG 1 cut(s) 36
XapI RAATTY 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.