Rh4CG180100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0000749
Physical Location & Seq
Forward (+)
39106037 .. 39106192
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG180100.1

Sequence Viewer

Length: 156 bp
ATGGCTGCATTTGGATCTGGGGAGTGGCTGAGGAGTGAGTCTGGGCCAGCGTTGGATTGTGGTCGGATTGGGGAGGCGTCTGACCCTGATCGGAAGGTGTGGCGGGATCTACGGTTTTCTGTTGCGGATCGGTGGATTGTTGGTGCTCTGTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.62

Weight (kDa)

5.09

Isoelectric Point (pI)

34.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 103, 125
AclWI GGATC 3 cut(s) 22, 114, 135
AcyI GRCGYC 1 cut(s) 77
Alw21I GWGCWC 1 cut(s) 148
AlwI GGATC 3 cut(s) 22, 114, 135
AoxI GGCC 1 cut(s) 44
ApeKI GCWGC 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 44
Bbv12I GWGCWC 1 cut(s) 148
BbvCI CCTCAGC 1 cut(s) 29
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 44
Bpu10I CCTNAGC 1 cut(s) 29
BsaHI GRCGYC 1 cut(s) 77
BseMII CTCAG 1 cut(s) 20
BseRI GAGGAG 1 cut(s) 46
BshFI GGCC 1 cut(s) 46
BsiHKAI GWGCWC 1 cut(s) 148
BsnI GGCC 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 4 cut(s) 14, 88, 106, 127
BspACI CCGC 2 cut(s) 103, 125
BspANI GGCC 1 cut(s) 46
BspCNI CTCAG 1 cut(s) 21
BspPI GGATC 3 cut(s) 22, 114, 135
BssMI GATC 4 cut(s) 14, 88, 106, 127
BssNI GRCGYC 1 cut(s) 77
Bst4CI ACNGT 1 cut(s) 114
BstACI GRCGYC 1 cut(s) 77
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 29
BstKTI GATC 4 cut(s) 17, 91, 109, 130
BstMBI GATC 4 cut(s) 14, 88, 106, 127
BstX2I RGATCY 2 cut(s) 14, 106
BstYI RGATCY 2 cut(s) 14, 106
BsuRI GGCC 1 cut(s) 46
Cac8I GCNNGC 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 44
CseI GACGC 1 cut(s) 66
CviJI RGCY 3 cut(s) 5, 28, 46
CviKI_1 RGCY 3 cut(s) 5, 28, 46
DdeI CTNAG 1 cut(s) 29
DpnI GATC 4 cut(s) 16, 90, 108, 129
DpnII GATC 4 cut(s) 14, 88, 106, 127
FauI CCCGC 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 46
HgaI GACGC 1 cut(s) 66
Hin1I GRCGYC 1 cut(s) 77
HinfI GANTC 1 cut(s) 38
Hpy188I TCNGA 3 cut(s) 66, 82, 93
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 114
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 29
Hsp92I GRCGYC 1 cut(s) 77
Kzo9I GATC 4 cut(s) 14, 88, 106, 127
LpnPI CCDG 4 cut(s) 3, 27, 60, 99
MalI GATC 4 cut(s) 16, 90, 108, 129
MboI GATC 4 cut(s) 14, 88, 106, 127
MflI RGATCY 2 cut(s) 14, 106
MhlI GDGCHC 1 cut(s) 148
MlyI GAGTC 1 cut(s) 47
MmeI TCCRAC 2 cut(s) 33, 44
MnlI CCTC 2 cut(s) 24, 67
NdeII GATC 4 cut(s) 14, 88, 106, 127
PkrI GCNGC 1 cut(s) 7
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
PspPI GGNCC 1 cut(s) 44
PsuI RGATCY 2 cut(s) 14, 106
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 4 cut(s) 14, 88, 106, 127
Sau96I GGNCC 1 cut(s) 44
SchI GAGTC 1 cut(s) 47
SduI GDGCHC 1 cut(s) 148
SetI ASST 1 cut(s) 99
SgeI CNNG 5 cut(s) 30, 54, 59, 98, 116
SsiI CCGC 2 cut(s) 103, 125
TaaI ACNGT 1 cut(s) 114
TseI GCWGC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.