Rroxscaffold_3G00245360

RNA polymerase sigma factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
38290356 .. 38295605
5250 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00245360.1

Sequence Viewer

Length: 243 bp
ATGTTCTTTGCATTCCGGGGTGTTTCAAGAGCACTGGTTGAAAATTCCAGAACCTTACTACTGCCTACACATTTGCATGAGAGGTTAGGGTTAATCAAAAATGCAAAAGTTAGATTGGAAGAGAAACAAATAACTCCATCTATCGATAGGATTGCAAAAAGCCTAGATATGTCCAAAAAGAAAGTTAGGAAGTTACTCAGGTATCAAGTGCTCGACAAACCAAGAGAGGCCAACACCTTATGA

Protein Analysis

80

Amino Acids

9.33

Weight (kDa)

10.76

Isoelectric Point (pI)

22.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Sigma70_r3 PF04539 27 - 67 1.1e-06 Sigma-70 region 3
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AgsI TTSAA 2 cut(s) 27, 41
Alw21I GWGCWC 2 cut(s) 34, 213
AoxI GGCC 1 cut(s) 228
ApoI RAATTY 1 cut(s) 43
AsuC2I CCSGG 1 cut(s) 17
BaeI ACNNNNGTAYC 2 cut(s) 185, 218
Bbv12I GWGCWC 2 cut(s) 34, 213
BccI CCATC 1 cut(s) 145
BcgI CGANNNNNNTGC 2 cut(s) 134, 168
BcnI CCSGG 1 cut(s) 17
BfaI CTAG 1 cut(s) 164
Bme1390I CCNGG 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 17
BpuMI CCSGG 1 cut(s) 17
Bsa29I ATCGAT 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 39
BseCI ATCGAT 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 211
BseNI ACTGG 1 cut(s) 39
BshFI GGCC 1 cut(s) 230
BshVI ATCGAT 1 cut(s) 144
BsiHKAI GWGCWC 2 cut(s) 34, 213
BsiSI CCGG 1 cut(s) 16
BsmI GAATGC 1 cut(s) 11
BsnI GGCC 1 cut(s) 230
Bsp1286I GDGCHC 2 cut(s) 34, 213
BspANI GGCC 1 cut(s) 230
BspCNI CTCAG 1 cut(s) 210
BspDI ATCGAT 1 cut(s) 144
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 15
Bsu15I ATCGAT 1 cut(s) 144
BsuRI GGCC 1 cut(s) 230
BsuTUI ATCGAT 1 cut(s) 144
BtsIMutI CAGTG 1 cut(s) 32
ClaI ATCGAT 1 cut(s) 144
CviAII CATG 1 cut(s) 77
CviJI RGCY 2 cut(s) 162, 230
CviKI_1 RGCY 2 cut(s) 162, 230
DdeI CTNAG 1 cut(s) 197
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
FaeI CATG 1 cut(s) 80
FaiI YATR 3 cut(s) 78, 170, 241
FatI CATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 164
HaeIII GGCC 1 cut(s) 230
HapII CCGG 1 cut(s) 16
Hin1II CATG 1 cut(s) 80
HpaII CCGG 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 27, 48
HpyCH4V TGCA 4 cut(s) 11, 76, 104, 155
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 1 cut(s) 80
LpnPI CCDG 4 cut(s) 20, 29, 61, 184
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 192
MboII GAAGA 1 cut(s) 131
MhlI GDGCHC 2 cut(s) 34, 213
MluCI AATT 1 cut(s) 43
MnlI CCTC 2 cut(s) 75, 220
MseI TTAA 1 cut(s) 92
MslI CAYNNNNRTG 1 cut(s) 75
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 17
Mva1269I GAATGC 1 cut(s) 11
NciI CCSGG 1 cut(s) 17
NlaIII CATG 1 cut(s) 80
PctI GAATGC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 17
SduI GDGCHC 2 cut(s) 34, 213
SetI ASST 4 cut(s) 56, 86, 203, 239
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 15
TaqI TCGA 2 cut(s) 144, 213
TasI AATT 1 cut(s) 43
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TscAI CASTG 1 cut(s) 39
TspRI CASTG 1 cut(s) 39
XapI RAATTY 1 cut(s) 43
XspI CTAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.