Rroxscaffold_3G00267980

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0000749
Physical Location & Seq
Forward (+)
61167062 .. 61172633
5572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00267980.1

Sequence Viewer

Length: 243 bp
ATGGAGGCCAAAGAAGAAAAAAAGGAGCTTACTGATTCAGCAAAGCACAATAGAACGGCTTTGAGTCTGAGTTTATTTGAGGATCTTCACTTACAGAGGTTGCTCTCTAGAAAAAGAGAGGAGACAAAACAAAGAGAGAGAACAGAGAATAAGGAAAAGAAACAGAAGAGAGAGGCGGAAAGTTGTTACTCAAAACAAAACAAGTGGAAGACCATTCTACTTGGTGCGGAGGTAGTGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.56

Weight (kDa)

9.48

Isoelectric Point (pI)

65.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 176, 227
AclWI GGATC 1 cut(s) 90
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
Alw26I GTCTC 1 cut(s) 116
AlwI GGATC 1 cut(s) 90
AoxI GGCC 1 cut(s) 6
BbsI GAAGAC 1 cut(s) 215
BceAI ACGGC 1 cut(s) 72
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 1 cut(s) 108
BpiI GAAGAC 1 cut(s) 215
BseMII CTCAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 134
BshFI GGCC 1 cut(s) 8
BsmAI GTCTC 1 cut(s) 116
BsnI GGCC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 2 cut(s) 176, 227
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 60
BspPI GGATC 1 cut(s) 90
BssMI GATC 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 161
BstDEI CTNAG 1 cut(s) 68
BstKTI GATC 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 1 cut(s) 82
BstV2I GAAGAC 1 cut(s) 215
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuRI GGCC 1 cut(s) 8
CspCI CAANNNNNGTGG 2 cut(s) 185, 220
CviJI RGCY 3 cut(s) 8, 28, 59
CviKI_1 RGCY 3 cut(s) 8, 28, 59
DdeI CTNAG 1 cut(s) 68
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 161
EarI CTCTTC 1 cut(s) 161
EciI GGCGGA 1 cut(s) 191
FspBI CTAG 1 cut(s) 108
HaeIII GGCC 1 cut(s) 8
HinfI GANTC 2 cut(s) 35, 64
Hpy188I TCNGA 1 cut(s) 69
Hpy188III TCNNGA 1 cut(s) 108
HpyCH4V TGCA 1 cut(s) 238
HpyF3I CTNAG 1 cut(s) 68
Kzo9I GATC 1 cut(s) 82
LmnI GCTCC 1 cut(s) 25
MaeI CTAG 1 cut(s) 108
MaeIII GTNAC 1 cut(s) 185
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 4 cut(s) 26, 77, 178, 220
MflI RGATCY 1 cut(s) 82
MlyI GAGTC 1 cut(s) 73
MnlI CCTC 5 cut(s) 73, 90, 112, 166, 223
NdeII GATC 1 cut(s) 82
PfeI GAWTC 1 cut(s) 35
PleI GAGTC 1 cut(s) 72
PpsI GAGTC 1 cut(s) 72
PsuI RGATCY 1 cut(s) 82
Sau3AI GATC 1 cut(s) 82
SchI GAGTC 1 cut(s) 73
SetI ASST 3 cut(s) 30, 101, 234
SgeI CNNG 3 cut(s) 120, 214, 233
SsiI CCGC 2 cut(s) 176, 227
SspMI CTAG 1 cut(s) 108
TfiI GAWTC 1 cut(s) 35
XbaI TCTAGA 1 cut(s) 107
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.