RchiOBHm_Chr4g0391511

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000749
Physical Location & Seq
Reverse (-)
6932034 .. 6933494
1461 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ36433

Sequence Viewer

Length: 156 bp
ATGGGGTTCACTCTTCTCTCTTCGATTACTGATTCAGTGCAGCACAATAGAACAGCTTCAAGTCTGAGATTATTTGAGGATCTCTACTTACAGAGGTTGCTCTCTAGTCAACAAATGCCTTGGTTATCTCTAAGCAGACCATTCTACTTCGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

8.36

Isoelectric Point (pI)

79.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 87
AgsI TTSAA 1 cut(s) 60
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AlwI GGATC 1 cut(s) 87
ApeKI GCWGC 1 cut(s) 40
Asp700I GAANNNNTTC 1 cut(s) 55
BbvI GCAGC 1 cut(s) 52
BfaI CTAG 1 cut(s) 105
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BsaJI CCNNGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 52
BsgI GTGCAG 1 cut(s) 59
Bsp143I GATC 1 cut(s) 79
BspCNI CTCAG 1 cut(s) 57
BspPI GGATC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 1 cut(s) 79
BssT1I CCWWGG 1 cut(s) 119
Bst6I CTCTTC 2 cut(s) 18, 25
BstDEI CTNAG 2 cut(s) 65, 131
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstV1I GCAGC 1 cut(s) 52
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BtsIMutI CAGTG 1 cut(s) 42
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DdeI CTNAG 2 cut(s) 65, 131
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 2 cut(s) 18, 25
EarI CTCTTC 2 cut(s) 18, 25
Eco130I CCWWGG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
Fnu4HI GCNGC 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 41
FspBI CTAG 1 cut(s) 105
FspEI CC 4 cut(s) 62, 79, 106, 132
GluI GCNGC 1 cut(s) 41
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HinfI GANTC 1 cut(s) 32
Hpy166II GTNNAC 2 cut(s) 9, 110
Hpy188I TCNGA 1 cut(s) 66
Hpy8I GTNNAC 2 cut(s) 9, 110
HpyCH4V TGCA 1 cut(s) 40
HpyF3I CTNAG 2 cut(s) 65, 131
Kzo9I GATC 1 cut(s) 79
Lsp1109I GCAGC 1 cut(s) 52
MaeI CTAG 1 cut(s) 105
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 2 cut(s) 5, 12
MflI RGATCY 1 cut(s) 79
MnlI CCTC 2 cut(s) 70, 87
MroXI GAANNNNTTC 1 cut(s) 55
NdeII GATC 1 cut(s) 79
PdmI GAANNNNTTC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 32
PkrI GCNGC 1 cut(s) 42
PsuI RGATCY 1 cut(s) 79
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 1 cut(s) 79
SetI ASST 2 cut(s) 58, 98
SgeI CNNG 3 cut(s) 72, 117, 132
SspMI CTAG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 23
TfiI GAWTC 1 cut(s) 32
TscAI CASTG 1 cut(s) 42
TseI GCWGC 1 cut(s) 40
TspRI CASTG 1 cut(s) 42
XmnI GAANNNNTTC 1 cut(s) 55
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.