Rh6BG092900

RNA polymerase sigma factor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
14662464 .. 14664791
2328 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG092900.1

Sequence Viewer

Length: 321 bp
ATGTTCTTTGCATTCCAGGGTGTTTCAAGAGCACTGGTTGAAAATTCCAGAACCTTACTACTGCCTACACATTTGCATGAGAGGTTAGGGTTAATCAAAAATGCAAAAGTTAGATTGGAACAGAAACGAATAACTCCATCTATTGATGTATTTTTTATTTTTTTTTGTGATCATCAGAAAGCAATTACTTTGTCAACTAAAGTATATATGAACATGCTGATGCCAGCAATGTTTATTTCTTTAATTACACTTTGTTTTCAGAGGATTACAGAAAGCCTGAATATGTCCAAAAAGAAAGTTAGGAAGTTACTCAGGTACTAA

Protein Analysis

106

Amino Acids

12.47

Weight (kDa)

10.4

Isoelectric Point (pI)

38.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 43
AfaI GTAC 1 cut(s) 317
AgsI TTSAA 2 cut(s) 27, 41
AjnI CCWGG 1 cut(s) 15
Alw21I GWGCWC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 43
Bbv12I GWGCWC 1 cut(s) 34
BccI CCATC 1 cut(s) 145
BciT130I CCWGG 1 cut(s) 17
BclI TGATCA 1 cut(s) 169
Bme1390I CCNGG 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 17
BmsI GCATC 1 cut(s) 210
BsaJI CCNNGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 39
Bse3DI GCAATG 1 cut(s) 234
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 16
BseMI GCAATG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 39
BsiHKAI GWGCWC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 11
Bsp1286I GDGCHC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 225
BstDEI CTNAG 1 cut(s) 311
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstNI CCWGG 1 cut(s) 17
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 32
Cac8I GCNNGC 1 cut(s) 225
Csp6I GTAC 1 cut(s) 316
CviAII CATG 2 cut(s) 77, 214
CviJI RGCY 1 cut(s) 276
CviKI_1 RGCY 1 cut(s) 276
CviQI GTAC 1 cut(s) 316
DdeI CTNAG 1 cut(s) 311
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
EcoRII CCWGG 1 cut(s) 15
FaeI CATG 2 cut(s) 80, 217
FaiI YATR 6 cut(s) 78, 205, 207, 209, 215, 284
FatI CATG 2 cut(s) 76, 213
FbaI TGATCA 1 cut(s) 169
Hin1II CATG 2 cut(s) 80, 217
HincII GTYRAC 1 cut(s) 195
HindII GTYRAC 1 cut(s) 195
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 2 cut(s) 177, 261
Hpy188III TCNNGA 2 cut(s) 27, 48
Hpy8I GTNNAC 1 cut(s) 195
HpyCH4V TGCA 3 cut(s) 11, 76, 104
HpyF3I CTNAG 1 cut(s) 311
Hsp92II CATG 2 cut(s) 80, 217
Ksp22I TGATCA 1 cut(s) 169
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 7 cut(s) 2, 20, 29, 61, 237, 290, 298
LweI GCATC 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 306
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MhlI GDGCHC 1 cut(s) 34
MluCI AATT 3 cut(s) 43, 183, 243
MnlI CCTC 2 cut(s) 75, 255
MseI TTAA 2 cut(s) 92, 242
MslI CAYNNNNRTG 2 cut(s) 75, 218
MspR9I CCNGG 1 cut(s) 17
Mva1269I GAATGC 1 cut(s) 11
MvaI CCWGG 1 cut(s) 17
NdeII GATC 1 cut(s) 169
NlaIII CATG 2 cut(s) 80, 217
NspI RCATGY 1 cut(s) 217
PctI GAATGC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
RsaI GTAC 1 cut(s) 317
RsaNI GTAC 1 cut(s) 316
RseI CAYNNNNRTG 2 cut(s) 75, 218
SaqAI TTAA 2 cut(s) 92, 242
Sau3AI GATC 1 cut(s) 169
ScrFI CCNGG 1 cut(s) 17
SduI GDGCHC 1 cut(s) 34
SetI ASST 3 cut(s) 56, 86, 317
SfaNI GCATC 1 cut(s) 210
SgeI CNNG 9 cut(s) 28, 29, 39, 47, 60, 89, 226, 236, 289
SmiMI CAYNNNNRTG 2 cut(s) 75, 218
Sse9I AATT 3 cut(s) 43, 183, 243
StyD4I CCNGG 1 cut(s) 15
TasI AATT 3 cut(s) 43, 183, 243
Tru1I TTAA 2 cut(s) 92, 242
Tru9I TTAA 2 cut(s) 92, 242
TscAI CASTG 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 224
TspRI CASTG 1 cut(s) 39
XapI RAATTY 1 cut(s) 43
XceI RCATGY 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.