RchiOBHm_Chr7g0199951

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0000981
Physical Location & Seq
Reverse (-)
17915666 .. 17916646
981 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17894

Sequence Viewer

Length: 201 bp
ATGACAAAAATGCTCTCTCTTCTCTCGAGAGCAACCCTAAGGCTGCAATCAGCCTTGATTGGCGGTGGCAGTGCTGCAAACTCCTTGACTCTCCACAAAGAGGATTCTCAGCTACGCAATGGCTCGGTAAATTGGATTTGGAAGGGTGGCAGAGCCTCTCTTTCTTCTCCCCTATTTGGCGGCGATGGCGATTGGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.02

Weight (kDa)

9.78

Isoelectric Point (pI)

60.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 63, 180
AfiI CCNNNNNNNGG 2 cut(s) 100, 176
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Ama87I CYCGRG 1 cut(s) 25
ApeKI GCWGC 2 cut(s) 43, 74
AvaI CYCGRG 1 cut(s) 25
AxyI CCTNAGG 1 cut(s) 38
BbvI GCAGC 2 cut(s) 30, 61
BccI CCATC 1 cut(s) 179
BisI GCNGC 3 cut(s) 44, 75, 181
BlsI GCNGC 3 cut(s) 45, 76, 182
BmeT110I CYCGRG 1 cut(s) 25
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 176
Bse21I CCTNAGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 124
BseLI CCNNNNNNNGG 2 cut(s) 100, 176
BseMI GCAATG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 122
BseXI GCAGC 2 cut(s) 30, 61
BsiHKCI CYCGRG 1 cut(s) 25
BslI CCNNNNNNNGG 2 cut(s) 100, 176
BsoBI CYCGRG 1 cut(s) 25
BspACI CCGC 2 cut(s) 63, 180
BspCNI CTCAG 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 124
Bst6I CTCTTC 1 cut(s) 24
BstDEI CTNAG 2 cut(s) 38, 108
BstMWI GCNNNNNNNGC 1 cut(s) 186
BstV1I GCAGC 2 cut(s) 30, 61
Bsu36I CCTNAGG 1 cut(s) 38
BtsI GCAGTG 1 cut(s) 76
BtsIMutI CAGTG 1 cut(s) 76
CviJI RGCY 5 cut(s) 43, 53, 112, 123, 155
CviKI_1 RGCY 5 cut(s) 43, 53, 112, 123, 155
DdeI CTNAG 2 cut(s) 38, 108
Eam1104I CTCTTC 1 cut(s) 24
EarI CTCTTC 1 cut(s) 24
Eco81I CCTNAGG 1 cut(s) 38
Eco88I CYCGRG 1 cut(s) 25
Fnu4HI GCNGC 3 cut(s) 44, 75, 181
Fsp4HI GCNGC 3 cut(s) 44, 75, 181
GluI GCNGC 3 cut(s) 44, 75, 181
HinfI GANTC 2 cut(s) 88, 104
Hpy188III TCNNGA 2 cut(s) 25, 27
HpyAV CCTTC 1 cut(s) 136
HpyCH4V TGCA 2 cut(s) 46, 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 186
HpyF3I CTNAG 2 cut(s) 38, 108
Lsp1109I GCAGC 2 cut(s) 30, 61
MboII GAAGA 2 cut(s) 11, 156
MluCI AATT 1 cut(s) 130
MlyI GAGTC 1 cut(s) 82
MnlI CCTC 2 cut(s) 94, 166
MwoI GCNNNNNNNGC 1 cut(s) 186
PaeR7I CTCGAG 1 cut(s) 25
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 3 cut(s) 45, 76, 182
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
SatI GCNGC 3 cut(s) 44, 75, 181
SchI GAGTC 1 cut(s) 82
SetI ASST 1 cut(s) 114
Sfr274I CTCGAG 1 cut(s) 25
SgeI CNNG 5 cut(s) 37, 39, 67, 97, 136
SlaI CTCGAG 1 cut(s) 25
SmlI CTYRAG 1 cut(s) 25
SmoI CTYRAG 1 cut(s) 25
Sse9I AATT 1 cut(s) 130
SsiI CCGC 2 cut(s) 63, 180
TaqI TCGA 1 cut(s) 26
TasI AATT 1 cut(s) 130
TauI GCSGC 1 cut(s) 183
TfiI GAWTC 1 cut(s) 104
TscAI CASTG 1 cut(s) 76
TseI GCWGC 2 cut(s) 43, 74
TspRI CASTG 1 cut(s) 76
XhoI CTCGAG 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.