Rmu_co8242583.1_g000001

ankyrin repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8242583.1
Physical Location & Seq
Forward (+)
15 .. 775
761 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8242583.1_g000001.1.cds

Sequence Viewer

Length: 761 bp
atgaatccctctgattcagctgagacggagagtagtccaacatcggcctatcatgccacgatattggaggagaccaacgcaatgttctattctgaatggaaccagccaaaatctataccagtcaagaaaagcttaagcggcatggatactaaggtgttcaaggcggcacgagagggcaatattgatgcccttagagaacatagtgattatcttcaccagatattgactccaaccaaaaacacagtcctccatgtctatatagcttgcgtaggcagtgcaaggttgacaaagtctgaagaattgctgaagtcagccgaggctgtaagggagatgcttaaaatgtgccagcggctactattgcagccaaacgagagcggtgatactgtcttacacttagcggcaagacacggacgtgctgacatagttggagttcttattcaggctgcaaaagtctggcatggtgacctcgaggaaggtatcacatcaaaagaagtatgctaccagtttctcataagaagacgtaacgaggagaaaaacacagccttgcacgaggcagtgctgtttaatcatctagatgtggtaaagatattgactggggaagaccctgagtttttgtactctgctaatgatgctggcgaaactccagtatacatggctgccgaaagaggatatcgcgaattggtttttgaaatccttgacacctgcacaagttcatcctaccaaggacccgatggtttaacagctctacacgttgcagctgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

254

Amino Acids

28.19

Weight (kDa)

5.38

Isoelectric Point (pI)

38.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000489)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g10380 FvH4_1g10390 FvH4_1g10400 FvH4_1g10401 FvH4_1g10402 FvH4_1g10430 FvH4_1g10430 FvH4_1g12830 FvH4_1g12830 FvH4_1g12850 FvH4_1g12870
malus_domestica MD02G1014000.v1.1 MD02G1116900.v1.1 MD02G1117100.v1.1 MD07G1083500.v1.1 MD15G1231900.v1.1 MD15G1232000.v1.1 MD15G1232100.v1.1 MD15G1232200.v1.1
prunus_persica Prupe.7G182000_v2.0.a1 Prupe.7G182300_v2.0.a1 Prupe.7G182400_v2.0.a1 Prupe.7G182500_v2.0.a1 Prupe.7G182600_v2.0.a1
pyrus_communis pycom02g09070 pycom02g09080 pycom08g18250 pycom08g18260 pycom08g18270 pycom08g18280 pycom08g18290 pycom15g20630 pycom15g20650 pycom15g20660
rosa_chinensis RchiOBHm_Chr2g0097241 RchiOBHm_Chr7g0213401 RchiOBHm_Chr7g0237491
rosa_laevigata RLG00000000998 RLG00000002808 RLG00000016714
rosa_multiflora Rmu_co8242583.1_g000001 Rmu_sc0002425.1_g000003 Rmu_sc0002425.1_g000009 Rmu_sc0002923.1_g000001 Rmu_sc0036942.1_g000001 Rmu_ssc0000262.1_g000026 Rmu_ssc0000262.1_g000027
rosa_roxburghii Rroxscaffold_2G00144810 Rroxscaffold_2G00144850 Rroxscaffold_3G00224130 Rroxscaffold_3G00245990 Rroxscaffold_6G00396730
rosa_rugosa Rorug02G0054300 Rorug02G0055200 Rorug02G0065700 Rorug05G0283500 Rorug07G0303700
rosa_samantha Rh2AG112200 Rh2AG299500 Rh2BG114800 Rh2CG116800 Rh2CG117000 Rh2DG116000 Rh2DG116200 Rh2DG323600 Rh6AG214000 Rh6CG172700 Rh6DG163900 Rh7AG273800 Rh7AG461200 Rh7BG306800 Rh7BG307200 Rh7BG431000 Rh7BG431300 Rh7CG292900 Rh7CG478400 Rh7DG281200 Rh7DG323600 Rh7DG323700 Rh7DG447700
rosa_wichuraiana Rw0G001860 Rw1G008050 Rw1G011650 Rw2G008760 Rw2G008770 Rw3G028490 Rw6G018710 Rw7G023740 Rw7G038160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 710
AbsI CCTCGAGG 1 cut(s) 467
Acc36I ACCTGC 1 cut(s) 710
AccBSI CCGCTC 1 cut(s) 375
AccI GTMKAC 1 cut(s) 648
AccII CGCG 1 cut(s) 675
AciI CCGC 5 cut(s) 138, 164, 349, 375, 398
AcuI CTGAAG 2 cut(s) 315, 326
AfaI GTAC 1 cut(s) 617
AflII CTTAAG 1 cut(s) 133
AflIII ACRYGT 1 cut(s) 748
AgsI TTSAA 2 cut(s) 160, 689
AjiI CACGTC 1 cut(s) 413
AjuI GAANNNNNNNTTGG 2 cut(s) 68, 100
AleI CACNNNNGTG 1 cut(s) 411
AluBI AGCT 5 cut(s) 20, 132, 263, 743, 758
AluI AGCT 5 cut(s) 20, 132, 263, 743, 758
Alw26I GTCTC 2 cut(s) 17, 65
Ama87I CYCGRG 1 cut(s) 467
AoxI GGCC 1 cut(s) 45
ApeKI GCWGC 5 cut(s) 361, 443, 656, 755, 758
ArsI GACNNNNNNTTYG 2 cut(s) 228, 260
AspS9I GGNCC 1 cut(s) 725
AsuHPI GGTGA 3 cut(s) 206, 389, 473
AvaI CYCGRG 1 cut(s) 467
AvaII GGWCC 1 cut(s) 725
BaeI ACNNNNGTAYC 2 cut(s) 138, 171
BauI CACGAG 2 cut(s) 168, 548
BbsI GAAGAC 2 cut(s) 523, 606
BbvI GCAGC 4 cut(s) 373, 430, 643, 745
BccI CCATC 1 cut(s) 725
BciVI GTATCC 1 cut(s) 139
BcoDI GTCTC 2 cut(s) 17, 65
BfaI CTAG 1 cut(s) 572
BfrI CTTAAG 1 cut(s) 133
BfuAI ACCTGC 1 cut(s) 710
BfuI GTATCC 1 cut(s) 139
BisI GCNGC 9 cut(s) 139, 165, 350, 362, 399, 444, 657, 756, 759
BlsI GCNGC 9 cut(s) 140, 166, 351, 363, 400, 445, 658, 757, 760
Bme18I GGWCC 1 cut(s) 725
BmeT110I CYCGRG 1 cut(s) 467
BmgBI CACGTC 1 cut(s) 413
BmgT120I GGNCC 1 cut(s) 725
BmiI GGNNCC 2 cut(s) 101, 727
BmrI ACTGGG 1 cut(s) 603
BmsI GCATC 3 cut(s) 175, 321, 619
BmuI ACTGGG 1 cut(s) 603
BpiI GAAGAC 2 cut(s) 523, 606
BpmI CTGGAG 1 cut(s) 627
BsaI GGTCTC 1 cut(s) 65
BsaJI CCNNGG 2 cut(s) 315, 721
Bse1I ACTGG 4 cut(s) 119, 502, 598, 644
Bse3DI GCAATG 1 cut(s) 87
BseDI CCNNGG 2 cut(s) 315, 721
BseGI GGATG 1 cut(s) 713
BseMI GCAATG 1 cut(s) 87
BseMII CTCAG 2 cut(s) 12, 597
BseNI ACTGG 4 cut(s) 119, 502, 598, 644
BseRI GAGGAG 2 cut(s) 83, 542
BseXI GCAGC 4 cut(s) 373, 430, 643, 745
BsgI GTGCAG 1 cut(s) 688
Bsh1236I CGCG 1 cut(s) 675
BshFI GGCC 1 cut(s) 47
BsiHKCI CYCGRG 1 cut(s) 467
BsmAI GTCTC 2 cut(s) 17, 65
BsmBI CGTCTC 1 cut(s) 17
BsnI GGCC 1 cut(s) 47
Bso31I GGTCTC 1 cut(s) 65
BsoBI CYCGRG 1 cut(s) 467
Bsp68I TCGCGA 1 cut(s) 675
BspACI CCGC 5 cut(s) 138, 164, 349, 375, 398
BspANI GGCC 1 cut(s) 47
BspCNI CTCAG 2 cut(s) 13, 598
BspFNI CGCG 1 cut(s) 675
BspLI GGNNCC 2 cut(s) 101, 727
BspMI ACCTGC 1 cut(s) 710
BspTI CTTAAG 1 cut(s) 133
BspTNI GGTCTC 1 cut(s) 65
BsrBI CCGCTC 1 cut(s) 375
BsrDI GCAATG 1 cut(s) 87
BsrI ACTGG 4 cut(s) 119, 502, 598, 644
BssECI CCNNGG 2 cut(s) 315, 721
BssNAI GTATAC 1 cut(s) 649
BssSI CACGAG 2 cut(s) 168, 548
BssT1I CCWWGG 1 cut(s) 721
Bst1107I GTATAC 1 cut(s) 649
Bst2BI CACGAG 2 cut(s) 168, 548
Bst4CI ACNGT 2 cut(s) 244, 385
BstAFI CTTAAG 1 cut(s) 133
BstC8I GCNNGC 3 cut(s) 265, 347, 634
BstDEI CTNAG 5 cut(s) 21, 150, 191, 394, 606
BstEII GGTNACC 1 cut(s) 461
BstF5I GGATG 1 cut(s) 713
BstFNI CGCG 1 cut(s) 675
BstMAI GTCTC 2 cut(s) 17, 65
BstMWI GCNNNNNNNGC 4 cut(s) 53, 138, 358, 629
BstPI GGTNACC 1 cut(s) 461
BstUI CGCG 1 cut(s) 675
BstV1I GCAGC 4 cut(s) 373, 430, 643, 745
BstV2I GAAGAC 2 cut(s) 523, 606
BstXI CCANNNNNNTGG 1 cut(s) 64
BstZ17I GTATAC 1 cut(s) 649
BsuI GTATCC 1 cut(s) 139
BsuRI GGCC 1 cut(s) 47
BtrI CACGTC 1 cut(s) 413
BtsCI GGATG 1 cut(s) 713
BtsI GCAGTG 2 cut(s) 280, 561
BtsIMutI CAGTG 2 cut(s) 280, 561
BtuMI TCGCGA 1 cut(s) 675
BveI ACCTGC 1 cut(s) 710
Cac8I GCNNGC 3 cut(s) 265, 347, 634
Cfr13I GGNCC 1 cut(s) 725
Csp6I GTAC 1 cut(s) 616
CviAII CATG 5 cut(s) 53, 142, 251, 458, 652
CviQI GTAC 1 cut(s) 616
DdeI CTNAG 5 cut(s) 21, 150, 191, 394, 606
Eco130I CCWWGG 1 cut(s) 721
Eco31I GGTCTC 1 cut(s) 65
Eco32I GATATC 1 cut(s) 671
Eco47I GGWCC 1 cut(s) 725
Eco57I CTGAAG 2 cut(s) 315, 326
Eco88I CYCGRG 1 cut(s) 467
Eco91I GGTNACC 1 cut(s) 461
EcoO109I RGGNCCY 1 cut(s) 725
EcoO65I GGTNACC 1 cut(s) 461
EcoRV GATATC 1 cut(s) 671
EcoT14I CCWWGG 1 cut(s) 721
ErhI CCWWGG 1 cut(s) 721
Esp3I CGTCTC 1 cut(s) 17
FaeI CATG 5 cut(s) 56, 145, 254, 461, 655
FalI AAGNNNNNCTT 2 cut(s) 116, 148
FatI CATG 5 cut(s) 52, 141, 250, 457, 651
FblI GTMKAC 1 cut(s) 648
Fnu4HI GCNGC 9 cut(s) 139, 165, 350, 362, 399, 444, 657, 756, 759
FokI GGATG 1 cut(s) 700
Fsp4HI GCNGC 9 cut(s) 139, 165, 350, 362, 399, 444, 657, 756, 759
FspBI CTAG 1 cut(s) 572
GluI GCNGC 9 cut(s) 139, 165, 350, 362, 399, 444, 657, 756, 759
GsuI CTGGAG 1 cut(s) 627
HaeIII GGCC 1 cut(s) 47
Hin1II CATG 5 cut(s) 56, 145, 254, 461, 655
HincII GTYRAC 1 cut(s) 285
HindII GTYRAC 1 cut(s) 285
HindIII AAGCTT 1 cut(s) 130
HinfI GANTC 3 cut(s) 4, 14, 226
HphI GGTGA 3 cut(s) 206, 389, 473
Hpy166II GTNNAC 2 cut(s) 285, 649
Hpy188I TCNGA 3 cut(s) 13, 94, 295
Hpy188III TCNNGA 3 cut(s) 124, 572, 674
Hpy8I GTNNAC 2 cut(s) 285, 649
HpyAV CCTTC 1 cut(s) 467
HpyCH4III ACNGT 2 cut(s) 244, 385
HpyCH4IV ACGT 3 cut(s) 412, 520, 750
HpyCH4V TGCA 6 cut(s) 278, 361, 446, 547, 705, 755
HpyF10VI GCNNNNNNNGC 4 cut(s) 53, 138, 358, 629
HpyF3I CTNAG 5 cut(s) 21, 150, 191, 394, 606
HpySE526I ACGT 3 cut(s) 412, 520, 750
Hsp92II CATG 5 cut(s) 56, 145, 254, 461, 655
Lsp1109I GCAGC 4 cut(s) 373, 430, 643, 745
LweI GCATC 3 cut(s) 175, 321, 619
MaeI CTAG 1 cut(s) 572
MaeII ACGT 3 cut(s) 412, 520, 750
MaeIII GTNAC 2 cut(s) 461, 521
MbiI CCGCTC 1 cut(s) 375
MboII GAAGA 4 cut(s) 203, 308, 528, 611
MluCI AATT 2 cut(s) 299, 677
MlyI GAGTC 1 cut(s) 220
MmeI TCCRAC 3 cut(s) 62, 254, 406
MseI TTAA 4 cut(s) 134, 336, 564, 737
MslI CAYNNNNRTG 2 cut(s) 411, 573
MspA1I CMGCKG 3 cut(s) 20, 349, 758
MspCI CTTAAG 1 cut(s) 133
MvnI CGCG 1 cut(s) 675
MwoI GCNNNNNNNGC 4 cut(s) 53, 138, 358, 629
NlaIII CATG 5 cut(s) 56, 145, 254, 461, 655
NlaIV GGNNCC 2 cut(s) 101, 727
NmeAIII GCCGAG 1 cut(s) 340
NmuCI GTSAC 1 cut(s) 461
NruI TCGCGA 1 cut(s) 675
OliI CACNNNNGTG 1 cut(s) 411
PaeR7I CTCGAG 1 cut(s) 467
PaqCI CACCTGC 1 cut(s) 710
PfeI GAWTC 2 cut(s) 4, 14
PflFI GACNNNGTC 1 cut(s) 289
PkrI GCNGC 9 cut(s) 140, 166, 351, 363, 400, 445, 658, 757, 760
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
PpuMI RGGWCCY 1 cut(s) 725
Psp5II RGGWCCY 1 cut(s) 725
PspEI GGTNACC 1 cut(s) 461
PspN4I GGNNCC 2 cut(s) 101, 727
PspPI GGNCC 1 cut(s) 725
PspPPI RGGWCCY 1 cut(s) 725
PspXI VCTCGAGB 1 cut(s) 467
PsyI GACNNNGTC 1 cut(s) 289
PvuII CAGCTG 2 cut(s) 20, 758
RruI TCGCGA 1 cut(s) 675
RsaI GTAC 1 cut(s) 617
RsaNI GTAC 1 cut(s) 616
RseI CAYNNNNRTG 2 cut(s) 411, 573
SaqAI TTAA 4 cut(s) 134, 336, 564, 737
SatI GCNGC 9 cut(s) 139, 165, 350, 362, 399, 444, 657, 756, 759
Sau96I GGNCC 1 cut(s) 725
SchI GAGTC 1 cut(s) 220
SfaNI GCATC 3 cut(s) 175, 321, 619
Sfr274I CTCGAG 1 cut(s) 467
SinI GGWCC 1 cut(s) 725
SlaI CTCGAG 1 cut(s) 467
SmiMI CAYNNNNRTG 2 cut(s) 411, 573
SmlI CTYRAG 2 cut(s) 133, 467
SmoI CTYRAG 2 cut(s) 133, 467
Sse9I AATT 2 cut(s) 299, 677
SsiI CCGC 5 cut(s) 138, 164, 349, 375, 398
SspI AATATT 1 cut(s) 181
SspMI CTAG 1 cut(s) 572
StyI CCWWGG 1 cut(s) 721
TaaI ACNGT 2 cut(s) 244, 385
TaiI ACGT 3 cut(s) 415, 523, 753
TaqI TCGA 1 cut(s) 468
TasI AATT 2 cut(s) 299, 677
TatI WGTACW 1 cut(s) 615
TauI GCSGC 4 cut(s) 141, 167, 352, 401
TfiI GAWTC 2 cut(s) 4, 14
Tru1I TTAA 4 cut(s) 134, 336, 564, 737
Tru9I TTAA 4 cut(s) 134, 336, 564, 737
TscAI CASTG 2 cut(s) 280, 561
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 5 cut(s) 361, 443, 656, 755, 758
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 2 cut(s) 17, 702
TspGWI ACGGA 2 cut(s) 41, 423
TspRI CASTG 2 cut(s) 280, 561
Tth111I GACNNNGTC 1 cut(s) 289
Vha464I CTTAAG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 725
XbaI TCTAGA 1 cut(s) 571
XcmI CCANNNNNNNNNTGG 1 cut(s) 728
XhoI CTCGAG 1 cut(s) 467
XmiI GTMKAC 1 cut(s) 648
XspI CTAG 1 cut(s) 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.