Rmu_sc0036942.1_g000001

ankyrin repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036942.1
OG0000489
Physical Location & Seq
Reverse (-)
1 .. 1821
1821 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036942.1_g000001.1.cds

Sequence Viewer

Length: 1305 bp
atgaatccctctgattcagctgagacggagatcagtagtccaacatcggcctatcatgccacgatactggaggagaccaacgcagtgttctgttctgaatggaatcagcagaaatctacaccagttaagagacgcttaagcggcatggatactcaggtgttcaaggcggcacgagagggcaatattgatgcccttagagaacatagtgatcatcttcaccaaatactgactccaaccaaaaacacagtcctccatgtctatatagcttgcgtaggcagtgcaaggttgacagagtctgaagaattgctgaaatcagccgaggttgtaagggagatgcttaaaatgtgccagcggctactattgcagccaaacgagagcggtgatactgctttacacttggcggcaagacacggacgtgctgacatagttgaagttcttattcgggctgcgaaagactggcatggcgacctcgaggaaggtatctcatcaaaagacgtatactaccagtttctcattagaagacctaacgaggagaaaaacacagccttgcacgagggagtgcggttcgatcaccttgatgtggttaagatattgactagggaagaccccgagtttttgtactctgctaataatggtggggaaactccgctctacatggctgccgagaggggatatccaaaattggtttttgaaatgctcgacacttgcacgaatccatcctaccaaggacccgatggtataacagctttacacgctgcagctacctacggtgatgaacaattaacgagaagattacttgagatggaaaggacgctagcaacagcatctgacgcactaggaatgactccacttcatttggctgcagctaagggtcgcgcttcaattgtgaaacaaatactggaatgtgataagtccactgcctacattggcaacatgtacaagttgacacccgttcattatgcagcccatgcagggcatgtagatgtactgaaacagcttattttctattgcccggacagttgcgaattggaggaccaagacggtcgcaatgccctacatttagcaattatcggtaatgaagaaaaagtagaagagtttgttcggaaagatccatggcttagtagcgtccttttaaatggcaaagattctgtcggaaacacaccgctccatcaaattgctacttctgatcaagaatacgatggcttggaatttatcagtgattctagagtcgataagatggcattcaacaaaaaaaataagaacgcgctagacatcattctgcatagaactgattctcaatggaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank Ank_2 Ank_3 Ank_4 Ank_5 PGG

Protein Analysis

435

Amino Acids

48.72

Weight (kDa)

5.47

Isoelectric Point (pI)

41.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000489)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g10380 FvH4_1g10390 FvH4_1g10400 FvH4_1g10401 FvH4_1g10402 FvH4_1g10430 FvH4_1g10430 FvH4_1g12830 FvH4_1g12830 FvH4_1g12850 FvH4_1g12870
malus_domestica MD02G1014000.v1.1 MD02G1116900.v1.1 MD02G1117100.v1.1 MD07G1083500.v1.1 MD15G1231900.v1.1 MD15G1232000.v1.1 MD15G1232100.v1.1 MD15G1232200.v1.1
prunus_persica Prupe.7G182000_v2.0.a1 Prupe.7G182300_v2.0.a1 Prupe.7G182400_v2.0.a1 Prupe.7G182500_v2.0.a1 Prupe.7G182600_v2.0.a1
pyrus_communis pycom02g09070 pycom02g09080 pycom08g18250 pycom08g18260 pycom08g18270 pycom08g18280 pycom08g18290 pycom15g20630 pycom15g20650 pycom15g20660
rosa_chinensis RchiOBHm_Chr2g0097241 RchiOBHm_Chr7g0213401 RchiOBHm_Chr7g0237491
rosa_laevigata RLG00000000998 RLG00000002808 RLG00000016714
rosa_multiflora Rmu_co8242583.1_g000001 Rmu_sc0002425.1_g000003 Rmu_sc0002425.1_g000009 Rmu_sc0002923.1_g000001 Rmu_sc0036942.1_g000001 Rmu_ssc0000262.1_g000026 Rmu_ssc0000262.1_g000027
rosa_roxburghii Rroxscaffold_2G00144810 Rroxscaffold_2G00144850 Rroxscaffold_3G00224130 Rroxscaffold_3G00245990 Rroxscaffold_6G00396730
rosa_rugosa Rorug02G0054300 Rorug02G0055200 Rorug02G0065700 Rorug05G0283500 Rorug07G0303700
rosa_samantha Rh2AG112200 Rh2AG299500 Rh2BG114800 Rh2CG116800 Rh2CG117000 Rh2DG116000 Rh2DG116200 Rh2DG323600 Rh6AG214000 Rh6CG172700 Rh6DG163900 Rh7AG273800 Rh7AG461200 Rh7BG306800 Rh7BG307200 Rh7BG431000 Rh7BG431300 Rh7CG292900 Rh7CG478400 Rh7DG281200 Rh7DG323600 Rh7DG323700 Rh7DG447700
rosa_wichuraiana Rw0G001860 Rw1G008050 Rw1G011650 Rw2G008760 Rw2G008770 Rw3G028490 Rw6G018710 Rw7G023740 Rw7G038160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 470
AccBSI CCGCTC 3 cut(s) 378, 649, 1165
AccI GTMKAC 1 cut(s) 498
AccII CGCG 2 cut(s) 876, 1265
AciI CCGC 8 cut(s) 141, 167, 352, 378, 401, 562, 647, 1163
AclWI GGATC 1 cut(s) 1103
AcsI RAATTY 1 cut(s) 1208
AcuI CTGAAG 1 cut(s) 318
AfaI GTAC 3 cut(s) 620, 938, 987
AfiI CCNNNNNNNGG 2 cut(s) 580, 972
AflII CTTAAG 1 cut(s) 136
AflIII ACRYGT 1 cut(s) 933
AgsI TTSAA 5 cut(s) 163, 431, 692, 882, 1246
AjiI CACGTC 1 cut(s) 416
AjuI GAANNNNNNNTTGG 2 cut(s) 71, 103
AleI CACNNNNGTG 1 cut(s) 414
AluBI AGCT 6 cut(s) 20, 266, 746, 761, 866, 997
AluI AGCT 6 cut(s) 20, 266, 746, 761, 866, 997
Alw26I GTCTC 3 cut(s) 17, 68, 124
AlwI GGATC 1 cut(s) 1103
AlwNI CAGNNNCTG 2 cut(s) 296, 827
Ama87I CYCGRG 2 cut(s) 470, 608
AoxI GGCC 1 cut(s) 48
ApeKI GCWGC 8 cut(s) 364, 446, 659, 755, 758, 860, 863, 962
ApoI RAATTY 1 cut(s) 1208
ArsI GACNNNNNNTTYG 4 cut(s) 231, 263, 1134, 1166
Asp700I GAANNNNTTC 1 cut(s) 1291
AspLEI GCGC 2 cut(s) 878, 1267
AspS9I GGNCC 2 cut(s) 728, 1033
AsuC2I CCSGG 1 cut(s) 1013
AsuHPI GGTGA 4 cut(s) 209, 392, 563, 782
AsuNHI GCTAGC 1 cut(s) 814
AvaI CYCGRG 2 cut(s) 470, 608
AvaII GGWCC 2 cut(s) 728, 1033
BaeI ACNNNNGTAYC 2 cut(s) 141, 174
BauI CACGAG 2 cut(s) 171, 551
BbsI GAAGAC 2 cut(s) 526, 609
BbvI GCAGC 8 cut(s) 376, 433, 646, 742, 770, 847, 875, 974
BccI CCATC 6 cut(s) 724, 728, 796, 1176, 1193, 1231
BciVI GTATCC 1 cut(s) 142
BclI TGATCA 2 cut(s) 208, 1186
BcnI CCSGG 1 cut(s) 1013
BcoDI GTCTC 3 cut(s) 17, 68, 124
BfaI CTAG 5 cut(s) 597, 815, 836, 1224, 1268
BfmI CTRYAG 2 cut(s) 756, 861
BfrI CTTAAG 1 cut(s) 136
BfuI GTATCC 1 cut(s) 142
Bme1390I CCNGG 1 cut(s) 1013
Bme18I GGWCC 2 cut(s) 728, 1033
BmeT110I CYCGRG 2 cut(s) 470, 608
BmgBI CACGTC 1 cut(s) 416
BmgT120I GGNCC 2 cut(s) 728, 1033
BmiI GGNNCC 1 cut(s) 730
BmrFI CCNGG 1 cut(s) 1013
BmsI GCATC 3 cut(s) 178, 324, 833
BmtI GCTAGC 1 cut(s) 818
BpiI GAAGAC 2 cut(s) 526, 609
BpmI CTGGAG 1 cut(s) 89
Bpu10I CCTNAGC 1 cut(s) 867
BpuEI CTTGAG 1 cut(s) 818
BpuMI CCSGG 1 cut(s) 1013
BsaI GGTCTC 1 cut(s) 68
BsaJI CCNNGG 3 cut(s) 318, 724, 1112
Bsc4I CCNNNNNNNGG 2 cut(s) 580, 972
Bse1I ACTGG 5 cut(s) 72, 122, 461, 505, 903
Bse3DI GCAATG 1 cut(s) 1054
BseDI CCNNGG 3 cut(s) 318, 724, 1112
BseGI GGATG 1 cut(s) 716
BseLI CCNNNNNNNGG 2 cut(s) 580, 972
BseMI GCAATG 1 cut(s) 1054
BseMII CTCAG 2 cut(s) 12, 167
BseNI ACTGG 5 cut(s) 72, 122, 461, 505, 903
BseRI GAGGAG 2 cut(s) 86, 545
BseXI GCAGC 8 cut(s) 376, 433, 646, 742, 770, 847, 875, 974
Bsh1236I CGCG 2 cut(s) 876, 1265
Bsh1285I CGRYCG 1 cut(s) 1045
BshFI GGCC 1 cut(s) 50
BsiEI CGRYCG 1 cut(s) 1045
BsiHKCI CYCGRG 2 cut(s) 470, 608
BsiSI CCGG 1 cut(s) 1013
BslI CCNNNNNNNGG 2 cut(s) 580, 972
BsmAI GTCTC 3 cut(s) 17, 68, 124
BsmBI CGTCTC 2 cut(s) 17, 124
BsmI GAATGC 1 cut(s) 1241
BsnI GGCC 1 cut(s) 50
Bso31I GGTCTC 1 cut(s) 68
BsoBI CYCGRG 2 cut(s) 470, 608
Bsp1407I TGTACA 1 cut(s) 936
Bsp143I GATC 5 cut(s) 30, 208, 568, 1108, 1186
Bsp19I CCATGG 1 cut(s) 1112
BspACI CCGC 8 cut(s) 141, 167, 352, 378, 401, 562, 647, 1163
BspANI GGCC 1 cut(s) 50
BspCNI CTCAG 2 cut(s) 13, 166
BspFNI CGCG 2 cut(s) 876, 1265
BspLI GGNNCC 1 cut(s) 730
BspMAI CTGCAG 2 cut(s) 760, 865
BspOI GCTAGC 1 cut(s) 818
BspPI GGATC 1 cut(s) 1103
BspTI CTTAAG 1 cut(s) 136
BspTNI GGTCTC 1 cut(s) 68
BsrBI CCGCTC 3 cut(s) 378, 649, 1165
BsrDI GCAATG 1 cut(s) 1054
BsrGI TGTACA 1 cut(s) 936
BsrI ACTGG 5 cut(s) 72, 122, 461, 505, 903
BssECI CCNNGG 3 cut(s) 318, 724, 1112
BssMI GATC 5 cut(s) 30, 208, 568, 1108, 1186
BssNAI GTATAC 1 cut(s) 499
BssSI CACGAG 2 cut(s) 171, 551
BssT1I CCWWGG 2 cut(s) 724, 1112
Bst1107I GTATAC 1 cut(s) 499
Bst2BI CACGAG 2 cut(s) 171, 551
Bst4CI ACNGT 4 cut(s) 247, 770, 1019, 1043
Bst6I CTCTTC 1 cut(s) 1086
BstAFI CTTAAG 1 cut(s) 136
BstAPI GCANNNNNTGC 1 cut(s) 968
BstAUI TGTACA 1 cut(s) 936
BstC8I GCNNGC 3 cut(s) 268, 350, 816
BstDEI CTNAG 5 cut(s) 21, 153, 194, 867, 1118
BstDSI CCRYGG 1 cut(s) 1112
BstF5I GGATG 1 cut(s) 716
BstFNI CGCG 2 cut(s) 876, 1265
BstHHI GCGC 2 cut(s) 878, 1267
BstKTI GATC 5 cut(s) 33, 211, 571, 1111, 1189
BstMAI GTCTC 3 cut(s) 17, 68, 124
BstMBI GATC 5 cut(s) 30, 208, 568, 1108, 1186
BstMCI CGRYCG 1 cut(s) 1045
BstMWI GCNNNNNNNGC 6 cut(s) 56, 141, 361, 752, 830, 968
BstNSI RCATGY 2 cut(s) 937, 980
BstSCI CCNGG 1 cut(s) 1011
BstSFI CTRYAG 2 cut(s) 756, 861
BstUI CGCG 2 cut(s) 876, 1265
BstV1I GCAGC 8 cut(s) 376, 433, 646, 742, 770, 847, 875, 974
BstV2I GAAGAC 2 cut(s) 526, 609
BstX2I RGATCY 1 cut(s) 1108
BstXI CCANNNNNNTGG 1 cut(s) 67
BstYI RGATCY 1 cut(s) 1108
BstZ17I GTATAC 1 cut(s) 499
BsuI GTATCC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 50
BtgI CCRYGG 1 cut(s) 1112
BtrI CACGTC 1 cut(s) 416
BtsCI GGATG 1 cut(s) 716
BtsI GCAGTG 3 cut(s) 90, 283, 915
BtsIMutI CAGTG 4 cut(s) 90, 283, 915, 1222
Cac8I GCNNGC 3 cut(s) 268, 350, 816
CaiI CAGNNNCTG 2 cut(s) 296, 827
CfoI GCGC 2 cut(s) 878, 1267
Cfr13I GGNCC 2 cut(s) 728, 1033
CseI GACGC 4 cut(s) 141, 820, 839, 1114
Csp6I GTAC 3 cut(s) 619, 937, 986
CspCI CAANNNNNGTGG 2 cut(s) 837, 872
CviAII CATG 9 cut(s) 56, 145, 254, 461, 655, 934, 968, 977, 1113
CviQI GTAC 3 cut(s) 619, 937, 986
DdeI CTNAG 5 cut(s) 21, 153, 194, 867, 1118
DpnI GATC 5 cut(s) 32, 210, 570, 1110, 1188
DpnII GATC 5 cut(s) 30, 208, 568, 1108, 1186
DraI TTTAAA 1 cut(s) 1134
Eam1104I CTCTTC 1 cut(s) 1086
EarI CTCTTC 1 cut(s) 1086
Eco130I CCWWGG 2 cut(s) 724, 1112
Eco31I GGTCTC 1 cut(s) 68
Eco32I GATATC 1 cut(s) 674
Eco47I GGWCC 2 cut(s) 728, 1033
Eco57I CTGAAG 1 cut(s) 318
Eco88I CYCGRG 2 cut(s) 470, 608
EcoO109I RGGNCCY 1 cut(s) 728
EcoRV GATATC 1 cut(s) 674
EcoT14I CCWWGG 2 cut(s) 724, 1112
ErhI CCWWGG 2 cut(s) 724, 1112
Esp3I CGTCTC 2 cut(s) 17, 124
FaeI CATG 9 cut(s) 59, 148, 257, 464, 658, 937, 971, 980, 1116
FalI AAGNNNNNCTT 2 cut(s) 119, 151
FatI CATG 9 cut(s) 55, 144, 253, 460, 654, 933, 967, 976, 1112
FbaI TGATCA 2 cut(s) 208, 1186
FblI GTMKAC 1 cut(s) 498
FokI GGATG 1 cut(s) 703
FspBI CTAG 5 cut(s) 597, 815, 836, 1224, 1268
GlaI GCGC 2 cut(s) 877, 1266
GsuI CTGGAG 1 cut(s) 89
HaeIII GGCC 1 cut(s) 50
HapII CCGG 1 cut(s) 1013
HgaI GACGC 4 cut(s) 141, 820, 839, 1114
HhaI GCGC 2 cut(s) 878, 1267
Hin1II CATG 9 cut(s) 59, 148, 257, 464, 658, 937, 971, 980, 1116
Hin6I GCGC 2 cut(s) 876, 1265
HinP1I GCGC 2 cut(s) 876, 1265
HincII GTYRAC 2 cut(s) 288, 945
HindII GTYRAC 2 cut(s) 288, 945
HpaII CCGG 1 cut(s) 1013
HphI GGTGA 4 cut(s) 209, 392, 563, 782
Hpy166II GTNNAC 4 cut(s) 288, 499, 915, 945
Hpy188I TCNGA 7 cut(s) 13, 97, 298, 829, 1104, 1154, 1186
Hpy188III TCNNGA 2 cut(s) 1190, 1224
Hpy8I GTNNAC 4 cut(s) 288, 499, 915, 945
HpyAV CCTTC 1 cut(s) 470
HpyCH4III ACNGT 4 cut(s) 247, 770, 1019, 1043
HpyCH4IV ACGT 2 cut(s) 415, 495
HpyCH4V TGCA 9 cut(s) 281, 364, 550, 708, 758, 863, 962, 971, 1282
HpyF10VI GCNNNNNNNGC 6 cut(s) 56, 141, 361, 752, 830, 968
HpyF3I CTNAG 5 cut(s) 21, 153, 194, 867, 1118
HpySE526I ACGT 2 cut(s) 415, 495
Hsp92II CATG 9 cut(s) 59, 148, 257, 464, 658, 937, 971, 980, 1116
HspAI GCGC 2 cut(s) 876, 1265
Ksp22I TGATCA 2 cut(s) 208, 1186
Kzo9I GATC 5 cut(s) 30, 208, 568, 1108, 1186
LmnI GCTCC 1 cut(s) 1170
LpnPI CCDG 9 cut(s) 53, 135, 140, 362, 442, 518, 884, 957, 1026
Lsp1109I GCAGC 8 cut(s) 376, 433, 646, 742, 770, 847, 875, 974
LweI GCATC 3 cut(s) 178, 324, 833
MaeI CTAG 5 cut(s) 597, 815, 836, 1224, 1268
MaeII ACGT 2 cut(s) 415, 495
MalI GATC 5 cut(s) 32, 210, 570, 1110, 1188
MbiI CCGCTC 3 cut(s) 378, 649, 1165
MboI GATC 5 cut(s) 30, 208, 568, 1108, 1186
MboII GAAGA 7 cut(s) 206, 311, 531, 614, 801, 1091, 1103
MfeI CAATTG 1 cut(s) 882
MflI RGATCY 1 cut(s) 1108
MluCI AATT 8 cut(s) 302, 680, 779, 882, 1025, 1065, 1173, 1208
MlyI GAGTC 4 cut(s) 223, 302, 838, 1236
MmeI TCCRAC 3 cut(s) 65, 257, 1132
MroXI GAANNNNTTC 1 cut(s) 1291
MseI TTAA 6 cut(s) 126, 137, 339, 585, 782, 1133
MslI CAYNNNNRTG 3 cut(s) 414, 576, 981
MspA1I CMGCKG 2 cut(s) 20, 352
MspCI CTTAAG 1 cut(s) 136
MspI CCGG 1 cut(s) 1013
MspR9I CCNGG 1 cut(s) 1013
MunI CAATTG 1 cut(s) 882
Mva1269I GAATGC 1 cut(s) 1241
MvnI CGCG 2 cut(s) 876, 1265
MwoI GCNNNNNNNGC 6 cut(s) 56, 141, 361, 752, 830, 968
NciI CCSGG 1 cut(s) 1013
NcoI CCATGG 1 cut(s) 1112
NdeII GATC 5 cut(s) 30, 208, 568, 1108, 1186
NheI GCTAGC 1 cut(s) 814
NlaIII CATG 9 cut(s) 59, 148, 257, 464, 658, 937, 971, 980, 1116
NlaIV GGNNCC 1 cut(s) 730
NmeAIII GCCGAG 2 cut(s) 343, 688
NspI RCATGY 2 cut(s) 937, 980
OliI CACNNNNGTG 1 cut(s) 414
PaeR7I CTCGAG 1 cut(s) 470
PciI ACATGT 1 cut(s) 933
PctI GAATGC 1 cut(s) 1241
PdmI GAANNNNTTC 1 cut(s) 1291
PfeI GAWTC 7 cut(s) 4, 14, 103, 712, 1145, 1220, 1292
PflFI GACNNNGTC 1 cut(s) 292
PleI GAGTC 4 cut(s) 223, 301, 838, 1235
PpsI GAGTC 4 cut(s) 223, 301, 838, 1235
PpuMI RGGWCCY 1 cut(s) 728
PscI ACATGT 1 cut(s) 933
Psp5II RGGWCCY 1 cut(s) 728
PspN4I GGNNCC 1 cut(s) 730
PspPI GGNCC 2 cut(s) 728, 1033
PspPPI RGGWCCY 1 cut(s) 728
PspXI VCTCGAGB 1 cut(s) 470
PstI CTGCAG 2 cut(s) 760, 865
PstNI CAGNNNCTG 2 cut(s) 296, 827
PsuI RGATCY 1 cut(s) 1108
PsyI GACNNNGTC 1 cut(s) 292
PvuII CAGCTG 1 cut(s) 20
RsaI GTAC 3 cut(s) 620, 938, 987
RsaNI GTAC 3 cut(s) 619, 937, 986
RseI CAYNNNNRTG 3 cut(s) 414, 576, 981
SaqAI TTAA 6 cut(s) 126, 137, 339, 585, 782, 1133
Sau3AI GATC 5 cut(s) 30, 208, 568, 1108, 1186
Sau96I GGNCC 2 cut(s) 728, 1033
SchI GAGTC 4 cut(s) 223, 302, 838, 1236
ScrFI CCNGG 1 cut(s) 1013
SfaNI GCATC 3 cut(s) 178, 324, 833
SfcI CTRYAG 2 cut(s) 756, 861
Sfr274I CTCGAG 1 cut(s) 470
SinI GGWCC 2 cut(s) 728, 1033
SlaI CTCGAG 1 cut(s) 470
SmiMI CAYNNNNRTG 3 cut(s) 414, 576, 981
SmlI CTYRAG 3 cut(s) 136, 470, 797
SmoI CTYRAG 3 cut(s) 136, 470, 797
Sse9I AATT 8 cut(s) 302, 680, 779, 882, 1025, 1065, 1173, 1208
SsiI CCGC 8 cut(s) 141, 167, 352, 378, 401, 562, 647, 1163
SspI AATATT 1 cut(s) 184
SspMI CTAG 5 cut(s) 597, 815, 836, 1224, 1268
StyD4I CCNGG 1 cut(s) 1011
StyI CCWWGG 2 cut(s) 724, 1112
TaaI ACNGT 4 cut(s) 247, 770, 1019, 1043
TaiI ACGT 2 cut(s) 418, 498
TaqI TCGA 4 cut(s) 471, 567, 699, 1230
TasI AATT 8 cut(s) 302, 680, 779, 882, 1025, 1065, 1173, 1208
TatI WGTACW 3 cut(s) 618, 936, 985
TauI GCSGC 4 cut(s) 144, 170, 355, 404
TfiI GAWTC 7 cut(s) 4, 14, 103, 712, 1145, 1220, 1292
Tru1I TTAA 6 cut(s) 126, 137, 339, 585, 782, 1133
Tru9I TTAA 6 cut(s) 126, 137, 339, 585, 782, 1133
TscAI CASTG 4 cut(s) 90, 283, 922, 1222
TseI GCWGC 8 cut(s) 364, 446, 659, 755, 758, 860, 863, 962
TspDTI ATGAA 5 cut(s) 17, 789, 842, 944, 1092
TspGWI ACGGA 2 cut(s) 41, 426
TspRI CASTG 4 cut(s) 90, 283, 922, 1222
Tth111I GACNNNGTC 1 cut(s) 292
Vha464I CTTAAG 1 cut(s) 136
VpaK11BI GGWCC 2 cut(s) 728, 1033
XapI RAATTY 1 cut(s) 1208
XbaI TCTAGA 1 cut(s) 1223
XceI RCATGY 2 cut(s) 937, 980
XcmI CCANNNNNNNNNTGG 1 cut(s) 731
XhoI CTCGAG 1 cut(s) 470
XmiI GTMKAC 1 cut(s) 498
XmnI GAANNNNTTC 1 cut(s) 1291
XspI CTAG 5 cut(s) 597, 815, 836, 1224, 1268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.