Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000244.1

Orthogroup ID

OG0000620

Physical Location & Seq

Genomic Coordinates Forward (+)

240000 .. 241759

Gene Structure 1760 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000244.1_g000041.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 765 bp

atgtggcaagaattggtttgcggaaattatctaaactcccattatcgtagtcatcagggggagacgcagacatcagggggagatgtctacatgttcacctcgaaacgtgaaggccatcgacaagggactgctgtgagttatcgggtatctgatgcagtacgagcgcttccttttgatatcatcactgagattttgagctggttgcctgtagattctttgctaaggttcaagtgtgtgtgcaaaaaatggcgttccttgcttctagactacaatttcattgcaaaacatatggttcgggcgagacctctgcaactttcctataaaaaagaatgggacccttacaaatatgatacggttctttatgatgaaaacttcaaacatatttcagatgtggctggcttgcttctggaggagagtcttacttctcgagttttccgaatcagaaactttgcaacgcatcaagtactttacttgcctgatgcacacgggaaatctaggtcagtgggttttgtttttgattcatccactggtgagtgtaaagccgcatgttttcattggaaacaggagggtgactctggctttgaagtagcctttgaagttctaagtatcggaaaggatgatcgatggaggactctgaagctgcccaagcaaaatggcgaaccgtacgtgggacgatattttacagcagctaaggaagaaggggctgctcatttggtggaaattattagagatggacaagatttcaagctagaagttcaatcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box F-box-like FBA_3

Protein Analysis

254

Amino Acids

29.32

Weight (kDa)

7.68

Isoelectric Point (pI)

41.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000620)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g03910 FvH4_4g13750 FvH4_6g21492 FvH4_6g21740 FvH4_6g24450
malus_domestica	MD05G1336000.v1.1 MD05G1336100.v1.1 MD10G1212400.v1.1 MD10G1311600.v1.1
prunus_persica	Prupe.4G112200_v2.0.a1 Prupe.4G130000_v2.0.a1 Prupe.4G130300_v2.0.a1 Prupe.4G219800_v2.0.a1 Prupe.4G219900_v2.0.a1 Prupe.4G220100_v2.0.a1
pyrus_communis	pycom05g30760 pycom10g26280
rosa_chinensis	RchiOBHm_Chr3g0478691 RchiOBHm_Chr3g0479021 RchiOBHm_Chr5g0004511 RchiOBHm_Chr5g0019881 RchiOBHm_Chr5g0021181
rosa_laevigata	RLG00000023610 RLG00000023612 RLG00000031235 RLG00000032481 RLG00000032506 RLG00000032589 RLG00000032592
rosa_multiflora	Rmu_co8446543.1_g000001 Rmu_sc0001396.1_g000010 Rmu_sc0002454.1_g000005 Rmu_sc0002531.1_g000072 Rmu_sc0002715.1_g000028 Rmu_sc0005207.1_g000008 Rmu_sc0005645.1_g000010 Rmu_sc0008074.1_g000017 Rmu_sc0012286.1_g000001 Rmu_ssc0000244.1_g000041
rosa_roxburghii	Rroxscaffold_1G00039650 Rroxscaffold_1G00058030 Rroxscaffold_1G00058290 Rroxscaffold_1G00071010 Rroxscaffold_6G00402820 Rroxscaffold_6G00403180
rosa_rugosa	Rorug03G0167000 Rorug03G0167100 Rorug03G0170200 Rorug03G0304300 Rorug05G0054800 Rorug05G0065000 Rorug05G0189900
rosa_samantha	Rh3AG219300 Rh3AG221100 Rh3BG251000 Rh3BG253400 Rh3BG253800 Rh3CG247800 Rh3CG250000 Rh3DG244100 Rh3DG245900 Rh4AG008500 Rh4CG009200 Rh4CG009600 Rh5AG275400 Rh5BG144100 Rh5BG144400 Rh5BG144500 Rh5BG147400 Rh5BG280200 Rh5CG043100 Rh5CG155800 Rh5CG312400 Rh5DG143800 Rh5DG146700 Rh5DG288400
rosa_wichuraiana	Rw3G019900 Rw5G012800 Rw5G013070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	87
AciI	CCGC	2 cut(s)	21, 543
AcuI	CTGAAG	1 cut(s)	656
AfaI	GTAC	3 cut(s)	159, 465, 665
AfeI	AGCGCT	1 cut(s)	165
AfiI	CCNNNNNNNGG	1 cut(s)	668
AflIII	ACRYGT	1 cut(s)	90
AgsI	TTSAA	6 cut(s)	229, 376, 584, 596, 745, 758
AluBI	AGCT	4 cut(s)	198, 640, 689, 748
AluI	AGCT	4 cut(s)	198, 640, 689, 748
Alw26I	GTCTC	2 cut(s)	56, 295
Ama87I	CYCGRG	1 cut(s)	426
Aor51HI	AGCGCT	1 cut(s)	165
AoxI	GGCC	1 cut(s)	112
ApeKI	GCWGC	3 cut(s)	640, 686, 704
ArsI	GACNNNNNNTTYG	2 cut(s)	563, 595
AspLEI	GCGC	1 cut(s)	166
AspS9I	GGNCC	1 cut(s)	334
AsuHPI	GGTGA	3 cut(s)	88, 542, 581
AvaI	CYCGRG	1 cut(s)	426
AvaII	GGWCC	1 cut(s)	334
BarI	GAAGNNNNNNTAC	2 cut(s)	150, 182
BbvI	GCAGC	3 cut(s)	627, 691, 698
BccI	CCATC	3 cut(s)	123, 618, 725
BcgI	CGANNNNNNTGC	2 cut(s)	289, 323
BcoDI	GTCTC	2 cut(s)	56, 295
BfaI	CTAG	3 cut(s)	263, 495, 749
BfmI	CTRYAG	1 cut(s)	207
BfoI	RGCGCY	1 cut(s)	167
BisI	GCNGC	4 cut(s)	543, 641, 687, 705
BlsI	GCNGC	4 cut(s)	544, 642, 688, 706
BmcAI	AGTACT	1 cut(s)	465
Bme18I	GGWCC	1 cut(s)	334
BmeT110I	CYCGRG	1 cut(s)	426
BmgT120I	GGNCC	1 cut(s)	334
BmiI	GGNNCC	2 cut(s)	335, 336
BmsI	GCATC	3 cut(s)	142, 466, 469
BplI	GAGNNNNNCTC	2 cut(s)	557, 589
BpmI	CTGGAG	1 cut(s)	428
Bpu10I	CCTNAGC	2 cut(s)	221, 690
Bsa29I	ATCGAT	1 cut(s)	622
BsaAI	YACGTR	1 cut(s)	667
BsaI	GGTCTC	1 cut(s)	295
Bsc4I	CCNNNNNNNGG	1 cut(s)	668
Bse1I	ACTGG	1 cut(s)	532
Bse3DI	GCAATG	1 cut(s)	276
BseCI	ATCGAT	1 cut(s)	622
BseGI	GGATG	2 cut(s)	521, 622
BseLI	CCNNNNNNNGG	1 cut(s)	668
BseMI	GCAATG	1 cut(s)	276
BseMII	CTCAG	1 cut(s)	177
BseNI	ACTGG	1 cut(s)	532
BseRI	GAGGAG	1 cut(s)	425
BseXI	GCAGC	3 cut(s)	627, 691, 698
BshFI	GGCC	1 cut(s)	114
BshVI	ATCGAT	1 cut(s)	622
BsiHKCI	CYCGRG	1 cut(s)	426
BsiWI	CGTACG	1 cut(s)	663
BslFI	GGGAC	3 cut(s)	139, 347, 684
BslI	CCNNNNNNNGG	1 cut(s)	668
BsmAI	GTCTC	2 cut(s)	56, 295
BsmBI	CGTCTC	1 cut(s)	56
BsmFI	GGGAC	3 cut(s)	139, 347, 684
BsnI	GGCC	1 cut(s)	114
Bso31I	GGTCTC	1 cut(s)	295
BsoBI	CYCGRG	1 cut(s)	426
Bsp143I	GATC	1 cut(s)	619
BspACI	CCGC	2 cut(s)	21, 543
BspANI	GGCC	1 cut(s)	114
BspCNI	CTCAG	1 cut(s)	178
BspDI	ATCGAT	1 cut(s)	622
BspLI	GGNNCC	2 cut(s)	335, 336
BspTNI	GGTCTC	1 cut(s)	295
BsrDI	GCAATG	1 cut(s)	276
BsrI	ACTGG	1 cut(s)	532
BssMI	GATC	1 cut(s)	619
Bst4CI	ACNGT	2 cut(s)	355, 663
BstBAI	YACGTR	1 cut(s)	667
BstC8I	GCNNGC	2 cut(s)	397, 401
BstDEI	CTNAG	4 cut(s)	186, 221, 602, 690
BstF5I	GGATG	2 cut(s)	521, 622
BstH2I	RGCGCY	1 cut(s)	167
BstHHI	GCGC	1 cut(s)	166
BstKTI	GATC	1 cut(s)	622
BstMAI	GTCTC	2 cut(s)	56, 295
BstMBI	GATC	1 cut(s)	619
BstMWI	GCNNNNNNNGC	3 cut(s)	161, 256, 646
BstNSI	RCATGY	2 cut(s)	94, 549
BstSFI	CTRYAG	1 cut(s)	207
BstV1I	GCAGC	3 cut(s)	627, 691, 698
Bsu15I	ATCGAT	1 cut(s)	622
BsuRI	GGCC	1 cut(s)	114
BsuTUI	ATCGAT	1 cut(s)	622
BtsCI	GGATG	2 cut(s)	521, 622
BtsIMutI	CAGTG	3 cut(s)	183, 507, 525
Cac8I	GCNNGC	2 cut(s)	397, 401
CfoI	GCGC	1 cut(s)	166
Cfr13I	GGNCC	1 cut(s)	334
ClaI	ATCGAT	1 cut(s)	622
CseI	GACGC	1 cut(s)	73
Csp6I	GTAC	3 cut(s)	158, 464, 664
CviAII	CATG	2 cut(s)	91, 546
CviQI	GTAC	3 cut(s)	158, 464, 664
DdeI	CTNAG	4 cut(s)	186, 221, 602, 690
DpnI	GATC	1 cut(s)	621
DpnII	GATC	1 cut(s)	619
Eco31I	GGTCTC	1 cut(s)	295
Eco32I	GATATC	1 cut(s)	178
Eco47I	GGWCC	1 cut(s)	334
Eco47III	AGCGCT	1 cut(s)	165
Eco57I	CTGAAG	1 cut(s)	656
Eco88I	CYCGRG	1 cut(s)	426
EcoO109I	RGGNCCY	1 cut(s)	334
EcoRV	GATATC	1 cut(s)	178
Esp3I	CGTCTC	1 cut(s)	56
FaeI	CATG	2 cut(s)	94, 549
FaiI	YATR	8 cut(s)	92, 288, 290, 321, 348, 363, 381, 547
FaqI	GGGAC	3 cut(s)	139, 347, 684
FatI	CATG	2 cut(s)	90, 545
FauNDI	CATATG	1 cut(s)	288
FblI	GTMKAC	1 cut(s)	87
Fnu4HI	GCNGC	4 cut(s)	543, 641, 687, 705
FokI	GGATG	2 cut(s)	508, 629
Fsp4HI	GCNGC	4 cut(s)	543, 641, 687, 705
FspBI	CTAG	3 cut(s)	263, 495, 749
GlaI	GCGC	1 cut(s)	165
GluI	GCNGC	4 cut(s)	543, 641, 687, 705
GsuI	CTGGAG	1 cut(s)	428
HaeII	RGCGCY	1 cut(s)	167
HaeIII	GGCC	1 cut(s)	114
HgaI	GACGC	1 cut(s)	73
HhaI	GCGC	1 cut(s)	166
Hin1II	CATG	2 cut(s)	94, 549
Hin6I	GCGC	1 cut(s)	164
HinP1I	GCGC	1 cut(s)	164
HinfI	GANTC	6 cut(s)	212, 415, 438, 518, 572, 631
HphI	GGTGA	3 cut(s)	88, 542, 581
Hpy166II	GTNNAC	2 cut(s)	88, 96
Hpy188I	TCNGA	6 cut(s)	151, 388, 437, 443, 611, 636
Hpy188III	TCNNGA	4 cut(s)	263, 407, 426, 762
Hpy8I	GTNNAC	2 cut(s)	88, 96
HpyAV	CCTTC	2 cut(s)	104, 692
HpyCH4III	ACNGT	2 cut(s)	355, 663
HpyCH4IV	ACGT	2 cut(s)	106, 666
HpyCH4V	TGCA	6 cut(s)	155, 240, 281, 310, 452, 482
HpyF10VI	GCNNNNNNNGC	3 cut(s)	161, 256, 646
HpyF3I	CTNAG	4 cut(s)	186, 221, 602, 690
HpySE526I	ACGT	2 cut(s)	106, 666
Hsp92II	CATG	2 cut(s)	94, 549
HspAI	GCGC	1 cut(s)	164
KflI	GGGWCCC	1 cut(s)	334
Kzo9I	GATC	1 cut(s)	619
Lsp1109I	GCAGC	3 cut(s)	627, 691, 698
LweI	GCATC	3 cut(s)	142, 466, 469
MaeI	CTAG	3 cut(s)	263, 495, 749
MaeII	ACGT	2 cut(s)	106, 666
MaeIII	GTNAC	1 cut(s)	569
MalI	GATC	1 cut(s)	621
MboI	GATC	1 cut(s)	619
MboII	GAAGA	1 cut(s)	707
MluCI	AATT	4 cut(s)	11, 25, 271, 720
MlyI	GAGTC	3 cut(s)	424, 566, 625
MnlI	CCTC	5 cut(s)	109, 315, 403, 559, 621
MwoI	GCNNNNNNNGC	3 cut(s)	161, 256, 646
NdeI	CATATG	1 cut(s)	288
NdeII	GATC	1 cut(s)	619
NlaIII	CATG	2 cut(s)	94, 549
NlaIV	GGNNCC	2 cut(s)	335, 336
NmuCI	GTSAC	1 cut(s)	569
NspI	RCATGY	2 cut(s)	94, 549
PaeR7I	CTCGAG	1 cut(s)	426
PciI	ACATGT	1 cut(s)	90
PcsI	WCGNNNNNNNCGW	1 cut(s)	433
PfeI	GAWTC	3 cut(s)	212, 438, 518
Pfl23II	CGTACG	1 cut(s)	663
PkrI	GCNGC	4 cut(s)	544, 642, 688, 706
PleI	GAGTC	3 cut(s)	423, 566, 625
PpsI	GAGTC	3 cut(s)	423, 566, 625
Ppu21I	YACGTR	1 cut(s)	667
PpuMI	RGGWCCY	1 cut(s)	334
PscI	ACATGT	1 cut(s)	90
Psp5II	RGGWCCY	1 cut(s)	334
PspLI	CGTACG	1 cut(s)	663
PspN4I	GGNNCC	2 cut(s)	335, 336
PspPI	GGNCC	1 cut(s)	334
PspPPI	RGGWCCY	1 cut(s)	334
RsaI	GTAC	3 cut(s)	159, 465, 665
RsaNI	GTAC	3 cut(s)	158, 464, 664
SatI	GCNGC	4 cut(s)	543, 641, 687, 705
Sau3AI	GATC	1 cut(s)	619
Sau96I	GGNCC	1 cut(s)	334
ScaI	AGTACT	1 cut(s)	465
SchI	GAGTC	3 cut(s)	424, 566, 625
SfaNI	GCATC	3 cut(s)	142, 466, 469
SfcI	CTRYAG	1 cut(s)	207
Sfr274I	CTCGAG	1 cut(s)	426
SinI	GGWCC	1 cut(s)	334
SlaI	CTCGAG	1 cut(s)	426
SmlI	CTYRAG	1 cut(s)	426
SmoI	CTYRAG	1 cut(s)	426
Sse9I	AATT	4 cut(s)	11, 25, 271, 720
SsiI	CCGC	2 cut(s)	21, 543
SspMI	CTAG	3 cut(s)	263, 495, 749
TaaI	ACNGT	2 cut(s)	355, 663
TaiI	ACGT	2 cut(s)	109, 669
TaqI	TCGA	4 cut(s)	101, 118, 427, 622
TasI	AATT	4 cut(s)	11, 25, 271, 720
TatI	WGTACW	1 cut(s)	463
TauI	GCSGC	1 cut(s)	545
TfiI	GAWTC	3 cut(s)	212, 438, 518
TscAI	CASTG	3 cut(s)	190, 507, 532
TseFI	GTSAC	1 cut(s)	569
TseI	GCWGC	3 cut(s)	640, 686, 704
Tsp45I	GTSAC	1 cut(s)	569
TspDTI	ATGAA	4 cut(s)	265, 381, 510, 542
TspRI	CASTG	3 cut(s)	190, 507, 532
VpaK11BI	GGWCC	1 cut(s)	334
XbaI	TCTAGA	1 cut(s)	262
XceI	RCATGY	2 cut(s)	94, 549
XhoI	CTCGAG	1 cut(s)	426
XmiI	GTMKAC	1 cut(s)	87
XspI	CTAG	3 cut(s)	263, 495, 749
ZrmI	AGTACT	1 cut(s)	465

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.