FvH4_2g27290

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
21693731 .. 21694847
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g27290.t2

Sequence Viewer

Length: 357 bp
ATGGCTCCACAGGAATCAGTTGGAAACACACACACAGCCTTAACTCGAGCTCAACGCCAAGATGAGCTTCTGAACATGTTTCCTGGCACTGCAAAGGTTGTTCTTCGTCCAAGAACAAATCCAGATGGGTCTGAAATTGTTACCAGAACTGATTATGAGTTTCCTGATCTTAAATGTAAGCTCCTGATGAAGAATCTTTATCAGGCGATGCGTTTGATTGGGAGAGATCATGGATATATCGCAAATACTATTCAATCACATATACGATTTTCCTGTGGTATTGTAGTGGACCTCGATGCGATGGAGAAGGAAATTAGGAATGGCTTTGCTACATCTCCAAGTTCGGTTCAACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.27

Weight (kDa)

7.82

Isoelectric Point (pI)

33.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 75
AgsI TTSAA 2 cut(s) 254, 350
AjnI CCWGG 1 cut(s) 82
AjuI GAANNNNNNNTTGG 2 cut(s) 51, 83
AluBI AGCT 3 cut(s) 50, 67, 181
AluI AGCT 3 cut(s) 50, 67, 181
Alw21I GWGCWC 1 cut(s) 52
Ama87I CYCGRG 1 cut(s) 45
AspS9I GGNCC 1 cut(s) 289
AvaI CYCGRG 1 cut(s) 45
AvaII GGWCC 1 cut(s) 289
BanII GRGCYC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 52
BccI CCATC 2 cut(s) 119, 295
BciT130I CCWGG 1 cut(s) 84
Bme1390I CCNGG 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 289
BmeT110I CYCGRG 1 cut(s) 45
BmgT120I GGNCC 1 cut(s) 289
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 84
BmsI GCATC 2 cut(s) 198, 286
BseBI CCWGG 1 cut(s) 84
BsiHKAI GWGCWC 1 cut(s) 52
BsiHKCI CYCGRG 1 cut(s) 45
BsoBI CYCGRG 1 cut(s) 45
Bsp1286I GDGCHC 1 cut(s) 52
Bsp143I GATC 2 cut(s) 166, 226
BspLI GGNNCC 1 cut(s) 6
BssMI GATC 2 cut(s) 166, 226
Bst2UI CCWGG 1 cut(s) 84
BstKTI GATC 2 cut(s) 169, 229
BstMBI GATC 2 cut(s) 166, 226
BstNI CCWGG 1 cut(s) 84
BstNSI RCATGY 1 cut(s) 79
BstSCI CCNGG 1 cut(s) 82
BtgZI GCGATG 2 cut(s) 221, 314
BtsI GCAGTG 1 cut(s) 87
BtsIMutI CAGTG 1 cut(s) 87
Cfr13I GGNCC 1 cut(s) 289
CviAII CATG 2 cut(s) 76, 230
CviJI RGCY 6 cut(s) 5, 38, 50, 67, 181, 324
CviKI_1 RGCY 6 cut(s) 5, 38, 50, 67, 181, 324
DpnI GATC 2 cut(s) 168, 228
DpnII GATC 2 cut(s) 166, 226
Ecl136II GAGCTC 1 cut(s) 50
Eco24I GRGCYC 1 cut(s) 52
Eco47I GGWCC 1 cut(s) 289
Eco53kI GAGCTC 1 cut(s) 50
Eco88I CYCGRG 1 cut(s) 45
EcoICRI GAGCTC 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 82
EcoT38I GRGCYC 1 cut(s) 52
FaeI CATG 2 cut(s) 79, 233
FaiI YATR 6 cut(s) 77, 156, 231, 237, 261, 263
FalI AAGNNNNNCTT 2 cut(s) 51, 83
FatI CATG 2 cut(s) 75, 229
FriOI GRGCYC 1 cut(s) 52
Hin1II CATG 2 cut(s) 79, 233
HinfI GANTC 2 cut(s) 14, 193
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 2 cut(s) 72, 133
Hpy188III TCNNGA 3 cut(s) 122, 164, 184
Hpy8I GTNNAC 1 cut(s) 289
HpyAV CCTTC 1 cut(s) 301
HpyCH4V TGCA 1 cut(s) 92
Hsp92II CATG 2 cut(s) 79, 233
Kzo9I GATC 2 cut(s) 166, 226
LmnI GCTCC 2 cut(s) 10, 186
LpnPI CCDG 8 cut(s) 69, 96, 135, 157, 177, 188, 197, 286
LweI GCATC 2 cut(s) 198, 286
MaeIII GTNAC 1 cut(s) 139
MalI GATC 2 cut(s) 168, 228
MboI GATC 2 cut(s) 166, 226
MboII GAAGA 2 cut(s) 95, 202
MhlI GDGCHC 1 cut(s) 52
MluCI AATT 2 cut(s) 135, 312
MnlI CCTC 1 cut(s) 302
MseI TTAA 2 cut(s) 41, 171
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
NdeII GATC 2 cut(s) 166, 226
NlaIII CATG 2 cut(s) 79, 233
NlaIV GGNNCC 1 cut(s) 6
NspI RCATGY 1 cut(s) 79
PaeR7I CTCGAG 1 cut(s) 45
PciI ACATGT 1 cut(s) 75
PfeI GAWTC 2 cut(s) 14, 193
PscI ACATGT 1 cut(s) 75
Psp124BI GAGCTC 1 cut(s) 52
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 289
PspXI VCTCGAGB 1 cut(s) 45
SacI GAGCTC 1 cut(s) 52
SaqAI TTAA 2 cut(s) 41, 171
Sau3AI GATC 2 cut(s) 166, 226
Sau96I GGNCC 1 cut(s) 289
ScrFI CCNGG 1 cut(s) 84
SduI GDGCHC 1 cut(s) 52
SetI ASST 5 cut(s) 52, 69, 99, 183, 294
SfaNI GCATC 2 cut(s) 198, 286
Sfr274I CTCGAG 1 cut(s) 45
SinI GGWCC 1 cut(s) 289
SlaI CTCGAG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 45
SmoI CTYRAG 1 cut(s) 45
Sse9I AATT 2 cut(s) 135, 312
SstI GAGCTC 1 cut(s) 52
StyD4I CCNGG 1 cut(s) 82
TaqI TCGA 2 cut(s) 46, 294
TasI AATT 2 cut(s) 135, 312
TfiI GAWTC 2 cut(s) 14, 193
Tru1I TTAA 2 cut(s) 41, 171
Tru9I TTAA 2 cut(s) 41, 171
TscAI CASTG 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 289
XceI RCATGY 1 cut(s) 79
XhoI CTCGAG 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.