Rh5DG382400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
58470222 .. 58471749
1528 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG382400.1

Sequence Viewer

Length: 345 bp
ATGGCTGAAGCTCCAGAATCCTGGTTCTCCATATTCACTGATTTATTTTTCGGAAAACCAAAACTGAAGAGTACTCCTAGTCAACGTCAGGATGAACTTGTGAAGAAATTCCCTGGGTCAAAAATTATTCGTCGTCCAAATCCAATGGAAGAAGCCGATGATTCACCTTACATTAAGTTTCCAAACCATAATTGCGAGAATTATATGAGAAGACTATATGAGGCAGTGAGAATTTACGGGAAGGATTATTGTGAGATGGATTACAATAGTCGCGTATATCAACGAATAGTACGCCAGGACTGTGGTATTGAAATTCACCCTGCAGATGAGTTAAAGAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

13.57

Weight (kDa)

6.15

Isoelectric Point (pI)

52.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 273
AcsI RAATTY 3 cut(s) 107, 231, 312
AcuI CTGAAG 2 cut(s) 27, 86
AfaI GTAC 2 cut(s) 73, 291
AgsI TTSAA 1 cut(s) 311
AjnI CCWGG 3 cut(s) 20, 112, 294
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
ApoI RAATTY 3 cut(s) 107, 231, 312
Asp700I GAANNNNTTC 1 cut(s) 107
AsuHPI GGTGA 2 cut(s) 156, 308
BbsI GAAGAC 1 cut(s) 217
BccI CCATC 1 cut(s) 250
BciT130I CCWGG 3 cut(s) 22, 114, 296
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 321
BmcAI AGTACT 1 cut(s) 73
Bme1390I CCNGG 3 cut(s) 22, 114, 296
BmrFI CCNGG 3 cut(s) 22, 114, 296
BpiI GAAGAC 1 cut(s) 217
BsaJI CCNNGG 2 cut(s) 112, 113
BseBI CCWGG 3 cut(s) 22, 114, 296
BseDI CCNNGG 2 cut(s) 112, 113
BseGI GGATG 1 cut(s) 97
Bsh1236I CGCG 1 cut(s) 273
BspFNI CGCG 1 cut(s) 273
BspMAI CTGCAG 1 cut(s) 325
BssECI CCNNGG 2 cut(s) 112, 113
Bst2UI CCWGG 3 cut(s) 22, 114, 296
Bst4CI ACNGT 1 cut(s) 302
Bst6I CTCTTC 1 cut(s) 62
BstF5I GGATG 1 cut(s) 97
BstFNI CGCG 1 cut(s) 273
BstNI CCWGG 3 cut(s) 22, 114, 296
BstSCI CCNGG 3 cut(s) 20, 112, 294
BstSFI CTRYAG 1 cut(s) 321
BstUI CGCG 1 cut(s) 273
BstV2I GAAGAC 1 cut(s) 217
BstXI CCANNNNNNTGG 2 cut(s) 21, 302
BtsCI GGATG 1 cut(s) 97
BtsI GCAGTG 1 cut(s) 231
BtsIMutI CAGTG 2 cut(s) 36, 231
Csp6I GTAC 2 cut(s) 72, 290
CviJI RGCY 3 cut(s) 5, 11, 155
CviKI_1 RGCY 3 cut(s) 5, 11, 155
CviQI GTAC 2 cut(s) 72, 290
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
Eco57I CTGAAG 2 cut(s) 27, 86
EcoRII CCWGG 3 cut(s) 20, 112, 294
FaiI YATR 7 cut(s) 32, 189, 204, 206, 217, 219, 277
FokI GGATG 1 cut(s) 104
FspBI CTAG 1 cut(s) 78
HincII GTYRAC 1 cut(s) 83
HindII GTYRAC 1 cut(s) 83
HinfI GANTC 2 cut(s) 17, 161
HphI GGTGA 2 cut(s) 156, 308
Hpy166II GTNNAC 1 cut(s) 83
Hpy188I TCNGA 1 cut(s) 53
Hpy188III TCNNGA 2 cut(s) 14, 89
Hpy8I GTNNAC 1 cut(s) 83
Hpy99I CGWCG 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 235
HpyCH4III ACNGT 1 cut(s) 302
HpyCH4IV ACGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 323
HpySE526I ACGT 1 cut(s) 85
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 9 cut(s) 7, 27, 34, 74, 99, 126, 281, 308, 333
MaeI CTAG 1 cut(s) 78
MaeII ACGT 1 cut(s) 85
MboII GAAGA 4 cut(s) 79, 115, 161, 222
MluCI AATT 6 cut(s) 107, 123, 190, 199, 231, 312
MnlI CCTC 1 cut(s) 214
MroXI GAANNNNTTC 1 cut(s) 107
MseI TTAA 2 cut(s) 174, 332
MspR9I CCNGG 3 cut(s) 22, 114, 296
MvaI CCWGG 3 cut(s) 22, 114, 296
MvnI CGCG 1 cut(s) 273
PasI CCCWGGG 1 cut(s) 113
PdmI GAANNNNTTC 1 cut(s) 107
PfeI GAWTC 2 cut(s) 17, 161
Psp6I CCWGG 3 cut(s) 20, 112, 294
PspGI CCWGG 3 cut(s) 20, 112, 294
PstI CTGCAG 1 cut(s) 325
RsaI GTAC 2 cut(s) 73, 291
RsaNI GTAC 2 cut(s) 72, 290
SaqAI TTAA 2 cut(s) 174, 332
ScaI AGTACT 1 cut(s) 73
ScrFI CCNGG 3 cut(s) 22, 114, 296
SetI ASST 3 cut(s) 13, 88, 169
SfcI CTRYAG 1 cut(s) 321
Sse9I AATT 6 cut(s) 107, 123, 190, 199, 231, 312
SspMI CTAG 1 cut(s) 78
StyD4I CCNGG 3 cut(s) 20, 112, 294
TaaI ACNGT 1 cut(s) 302
TaiI ACGT 1 cut(s) 88
TasI AATT 6 cut(s) 107, 123, 190, 199, 231, 312
TatI WGTACW 1 cut(s) 71
TfiI GAWTC 2 cut(s) 17, 161
Tru1I TTAA 2 cut(s) 174, 332
Tru9I TTAA 2 cut(s) 174, 332
TscAI CASTG 2 cut(s) 43, 231
TspDTI ATGAA 1 cut(s) 108
TspRI CASTG 2 cut(s) 43, 231
XapI RAATTY 3 cut(s) 107, 231, 312
XmnI GAANNNNTTC 1 cut(s) 107
XspI CTAG 1 cut(s) 78
ZrmI AGTACT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.