Rh6CG373000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
55909831 .. 55910597
767 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG373000.1

Sequence Viewer

Length: 270 bp
ATGGGTCTTTCCGGTTCTTCTCGTTGCCGTTCCGAAGAATCATCATCCTCTTCCTCCCAACAACCAAAAAGTCTTACTCAAGTTCAAGATGAGCTTGTCAAGAAATATCCTCCCGGTGCTGTGGTTATTCTGACCAGAACTCCTCCGAGATCAGCTGATGATTTTAGGCGGGAGTATTTTCTGCAGAAATACCCTACTTGTGAGGAATGGATTCAACGGTTCTACAAGATTTTCTTTTCAAAGACAAAACGAAGGGTCTATTTCTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.45

Weight (kDa)

9.74

Isoelectric Point (pI)

79.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 169
AgsI TTSAA 3 cut(s) 86, 215, 240
AluBI AGCT 2 cut(s) 94, 155
AluI AGCT 2 cut(s) 94, 155
Asp700I GAANNNNTTC 1 cut(s) 210
AsuC2I CCSGG 1 cut(s) 114
BceAI ACGGC 1 cut(s) 12
BcnI CCSGG 1 cut(s) 114
BfmI CTRYAG 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 114
BpuEI CTTGAG 1 cut(s) 63
BpuMI CCSGG 1 cut(s) 114
BsaWI WCCGGW 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 124, 154
BseGI GGATG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 132
BsiSI CCGG 2 cut(s) 12, 114
Bsp143I GATC 1 cut(s) 149
BspACI CCGC 1 cut(s) 169
BspMAI CTGCAG 1 cut(s) 186
BssMI GATC 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 219
Bst6I CTCTTC 1 cut(s) 55
BstF5I GGATG 1 cut(s) 44
BstKTI GATC 1 cut(s) 152
BstMBI GATC 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 182
BtsCI GGATG 1 cut(s) 44
CviJI RGCY 2 cut(s) 94, 155
CviKI_1 RGCY 2 cut(s) 94, 155
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
Eam1104I CTCTTC 1 cut(s) 55
EarI CTCTTC 1 cut(s) 55
FalI AAGNNNNNCTT 4 cut(s) 78, 110, 218, 250
FauI CCCGC 1 cut(s) 162
FokI GGATG 1 cut(s) 31
HapII CCGG 2 cut(s) 12, 114
HinfI GANTC 2 cut(s) 38, 211
HpaII CCGG 2 cut(s) 12, 114
Hpy188I TCNGA 3 cut(s) 34, 132, 147
Hpy188III TCNNGA 2 cut(s) 86, 100
HpyAV CCTTC 1 cut(s) 246
HpyCH4III ACNGT 1 cut(s) 219
HpyCH4V TGCA 1 cut(s) 184
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 25, 127, 148
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 3 cut(s) 9, 42, 47
MnlI CCTC 5 cut(s) 58, 64, 120, 153, 196
MroXI GAANNNNTTC 1 cut(s) 210
MspA1I CMGCKG 1 cut(s) 155
MspI CCGG 2 cut(s) 12, 114
MspR9I CCNGG 1 cut(s) 114
NciI CCSGG 1 cut(s) 114
NdeII GATC 1 cut(s) 149
PdmI GAANNNNTTC 1 cut(s) 210
PfeI GAWTC 2 cut(s) 38, 211
PstI CTGCAG 1 cut(s) 186
PvuII CAGCTG 1 cut(s) 155
Sau3AI GATC 1 cut(s) 149
ScrFI CCNGG 1 cut(s) 114
SetI ASST 2 cut(s) 96, 157
SfcI CTRYAG 1 cut(s) 182
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
SsiI CCGC 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 219
TfiI GAWTC 2 cut(s) 38, 211
XmnI GAANNNNTTC 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.