Rh1DG037500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
6048607 .. 6050356
1750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG037500.1

Sequence Viewer

Length: 180 bp
ATGACTATTGCAGCTTATCATGATATCAAGGACCTCTACAAGGCAATGCGATTGGGTCCTGAATGGCGGGCAGGGTTCTATCGCGATCAAATTCAGCAAGTTTGTGGTATTGATGTGGACATTGACAATGCGATAGAGAATGGCTCTGCTACTTCCTCTAATTTGGTTAAACAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.65

Weight (kDa)

4.99

Isoelectric Point (pI)

21.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 84
AciI CCGC 1 cut(s) 67
AcsI RAATTY 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 40
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
ApeKI GCWGC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 90
AspS9I GGNCC 2 cut(s) 31, 56
AvaII GGWCC 2 cut(s) 31, 56
BbvI GCAGC 1 cut(s) 23
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
Bme18I GGWCC 2 cut(s) 31, 56
BmgT120I GGNCC 2 cut(s) 31, 56
BmiI GGNNCC 1 cut(s) 57
BplI GAGNNNNNCTC 2 cut(s) 128, 160
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse3DI GCAATG 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMI GCAATG 1 cut(s) 51
BseXI GCAGC 1 cut(s) 23
Bsh1236I CGCG 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 40
Bsp143I GATC 1 cut(s) 85
Bsp68I TCGCGA 1 cut(s) 84
BspACI CCGC 1 cut(s) 67
BspFNI CGCG 1 cut(s) 84
BspHI TCATGA 1 cut(s) 19
BspLI GGNNCC 1 cut(s) 57
BsrDI GCAATG 1 cut(s) 51
BssMI GATC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 69
BstENI CCTNNNNNAGG 1 cut(s) 38
BstFNI CGCG 1 cut(s) 84
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
BstUI CGCG 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 23
BtuMI TCGCGA 1 cut(s) 84
Cac8I GCNNGC 1 cut(s) 69
CciI TCATGA 1 cut(s) 19
Cfr13I GGNCC 2 cut(s) 31, 56
CviAII CATG 1 cut(s) 20
CviJI RGCY 2 cut(s) 14, 144
CviKI_1 RGCY 2 cut(s) 14, 144
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
Eco32I GATATC 1 cut(s) 25
Eco47I GGWCC 2 cut(s) 31, 56
EcoNI CCTNNNNNAGG 1 cut(s) 38
EcoO109I RGGNCCY 2 cut(s) 31, 56
EcoRV GATATC 1 cut(s) 25
FaeI CATG 1 cut(s) 23
FaiI YATR 1 cut(s) 21
FatI CATG 1 cut(s) 19
FauI CCCGC 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
GluI GCNGC 1 cut(s) 12
Hin1II CATG 1 cut(s) 23
Hpy166II GTNNAC 1 cut(s) 118
Hpy188III TCNNGA 3 cut(s) 20, 59, 83
Hpy8I GTNNAC 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 11
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 2 cut(s) 57, 72
Lsp1109I GCAGC 1 cut(s) 23
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MluCI AATT 3 cut(s) 90, 160, 175
MnlI CCTC 2 cut(s) 44, 166
MseI TTAA 1 cut(s) 168
MvnI CGCG 1 cut(s) 84
NdeII GATC 1 cut(s) 85
NlaIII CATG 1 cut(s) 23
NlaIV GGNNCC 1 cut(s) 57
NruI TCGCGA 1 cut(s) 84
PagI TCATGA 1 cut(s) 19
PkrI GCNGC 1 cut(s) 13
PpuMI RGGWCCY 2 cut(s) 31, 56
Psp5II RGGWCCY 2 cut(s) 31, 56
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 2 cut(s) 31, 56
PspPPI RGGWCCY 2 cut(s) 31, 56
RruI TCGCGA 1 cut(s) 84
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 1 cut(s) 85
Sau96I GGNCC 2 cut(s) 31, 56
SetI ASST 2 cut(s) 16, 36
SgeI CNNG 8 cut(s) 32, 40, 52, 71, 80, 84, 95, 110
SinI GGWCC 2 cut(s) 31, 56
Sse9I AATT 3 cut(s) 90, 160, 175
SsiI CCGC 1 cut(s) 67
TasI AATT 3 cut(s) 90, 160, 175
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 1 cut(s) 11
VpaK11BI GGWCC 2 cut(s) 31, 56
XagI CCTNNNNNAGG 1 cut(s) 38
XapI RAATTY 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.