Rh6CG373300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000655
Physical Location & Seq
Forward (+)
55922517 .. 55924604
2088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG373300.1

Sequence Viewer

Length: 282 bp
ATGTTTCCTGGCACTGCTAAGGTTATTCTTCGTCCAAGAACAAATCCAGATGGCTCTGAAATTGTTACCATAAGTGATTATGAGTTTCCTGATCTTAGATGTAAGCGCTGGTTGAAGAATCTCTATCAGGCAATGCGGTTGTGTGGGAGGGATTATGGACGTCATGTAGCTGATATTCAATTAGATTTACCGACATTTTGTGGTATTGAAGTGGACCTCGATGCATTGGAGAAGGCTATAGGGAATGGCTTTGGCACATCTCCTAGTTCGGTTCAACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.42

Weight (kDa)

5.7

Isoelectric Point (pI)

40.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 163
AciI CCGC 1 cut(s) 136
AcyI GRCGYC 1 cut(s) 160
AfeI AGCGCT 1 cut(s) 107
AgsI TTSAA 4 cut(s) 115, 179, 209, 275
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
Aor51HI AGCGCT 1 cut(s) 107
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 214
AvaII GGWCC 1 cut(s) 214
BccI CCATC 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 9
BfaI CTAG 1 cut(s) 264
BfmI CTRYAG 1 cut(s) 237
BfoI RGCGCY 1 cut(s) 109
Bme1390I CCNGG 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 214
BmgT120I GGNCC 1 cut(s) 214
BmrFI CCNGG 1 cut(s) 9
BmsI GCATC 1 cut(s) 211
Bpu10I CCTNAGC 1 cut(s) 18
BsaHI GRCGYC 1 cut(s) 160
Bse3DI GCAATG 1 cut(s) 138
BseBI CCWGG 1 cut(s) 9
BseMI GCAATG 1 cut(s) 138
Bsp143I GATC 1 cut(s) 91
BspACI CCGC 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 138
BssMI GATC 1 cut(s) 91
BssNI GRCGYC 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 9
BstACI GRCGYC 1 cut(s) 160
BstDEI CTNAG 2 cut(s) 18, 95
BstH2I RGCGCY 1 cut(s) 109
BstHHI GCGC 1 cut(s) 108
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
BstSFI CTRYAG 1 cut(s) 237
BtsI GCAGTG 1 cut(s) 12
BtsIMutI CAGTG 1 cut(s) 12
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 214
CviAII CATG 1 cut(s) 164
CviJI RGCY 4 cut(s) 54, 170, 236, 249
CviKI_1 RGCY 4 cut(s) 54, 170, 236, 249
DdeI CTNAG 2 cut(s) 18, 95
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 214
Eco47III AGCGCT 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 7
EcoT22I ATGCAT 1 cut(s) 226
FaeI CATG 1 cut(s) 167
FaiI YATR 5 cut(s) 71, 81, 156, 165, 239
FatI CATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 264
GlaI GCGC 1 cut(s) 107
HaeII RGCGCY 1 cut(s) 109
HhaI GCGC 1 cut(s) 108
Hin1I GRCGYC 1 cut(s) 160
Hin1II CATG 1 cut(s) 167
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HinfI GANTC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 47, 89
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 18, 95
HpySE526I ACGT 1 cut(s) 160
Hsp92I GRCGYC 1 cut(s) 160
Hsp92II CATG 1 cut(s) 167
HspAI GCGC 1 cut(s) 106
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 5 cut(s) 21, 60, 94, 102, 113
LweI GCATC 1 cut(s) 211
MaeI CTAG 1 cut(s) 264
MaeII ACGT 1 cut(s) 160
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 20, 127
MluCI AATT 2 cut(s) 60, 179
MnlI CCTC 2 cut(s) 141, 227
Mph1103I ATGCAT 1 cut(s) 226
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
NdeII GATC 1 cut(s) 91
NlaIII CATG 1 cut(s) 167
NsiI ATGCAT 1 cut(s) 226
PfeI GAWTC 1 cut(s) 118
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
PspPI GGNCC 1 cut(s) 214
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 214
ScrFI CCNGG 1 cut(s) 9
SetI ASST 4 cut(s) 24, 163, 172, 219
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 237
SinI GGWCC 1 cut(s) 214
Sse9I AATT 2 cut(s) 60, 179
SsiI CCGC 1 cut(s) 136
SspMI CTAG 1 cut(s) 264
StyD4I CCNGG 1 cut(s) 7
TaiI ACGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 219
TasI AATT 2 cut(s) 60, 179
TfiI GAWTC 1 cut(s) 118
TscAI CASTG 1 cut(s) 19
TspRI CASTG 1 cut(s) 19
VpaK11BI GGWCC 1 cut(s) 214
XspI CTAG 1 cut(s) 264
ZraI GACGTC 1 cut(s) 161
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.