Rroxscaffold_4G00283790

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000655
Physical Location & Seq
Reverse (-)
5629232 .. 5630382
1151 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00283790.1

Sequence Viewer

Length: 333 bp
ATGGGTCTTTCGCCCTCCCTTCCAGTATTAACTCGTAGTCAGCGCCAAGATGAGCTTGTGAAGATGTGTCCAGGTGGCAATGCTAAGGTTATTCGTCGTCCAAAAACAAATCCAGATGGGTCTGAAATTGTTTGCAGAACAGATTATGAGTTTCCTGATTTGATTTGTGACAAATATATCAAGGACCTCTACAAGGCAATGCGATTGGGTCCTGAATGGCAGGCAGGGTTCTATCGCGATCAGATTCAGCAATTTTGTGGTATTGATGTGGACATTGACAACGCGATAGAGAATGGCTCTGCTACTTCCCCTAATTTGGTTGAACAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.39

Weight (kDa)

4.87

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 237, 284
AfiI CCNNNNNNNGG 2 cut(s) 193, 316
AgsI TTSAA 1 cut(s) 323
AjnI CCWGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AspLEI GCGC 1 cut(s) 45
AspS9I GGNCC 2 cut(s) 184, 209
AvaII GGWCC 2 cut(s) 184, 209
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 72
BfoI RGCGCY 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 72
Bme18I GGWCC 2 cut(s) 184, 209
BmgT120I GGNCC 2 cut(s) 184, 209
BmiI GGNNCC 1 cut(s) 210
BmrFI CCNGG 1 cut(s) 72
BplI GAGNNNNNCTC 2 cut(s) 281, 313
Bpu10I CCTNAGC 1 cut(s) 84
Bsc4I CCNNNNNNNGG 2 cut(s) 193, 316
Bse1I ACTGG 1 cut(s) 23
Bse3DI GCAATG 2 cut(s) 85, 204
BseBI CCWGG 1 cut(s) 72
BseLI CCNNNNNNNGG 2 cut(s) 193, 316
BseMI GCAATG 2 cut(s) 85, 204
BseNI ACTGG 1 cut(s) 23
Bsh1236I CGCG 2 cut(s) 237, 284
BslI CCNNNNNNNGG 2 cut(s) 193, 316
Bsp143I GATC 1 cut(s) 238
Bsp68I TCGCGA 1 cut(s) 237
BspFNI CGCG 2 cut(s) 237, 284
BspLI GGNNCC 1 cut(s) 210
BsrDI GCAATG 2 cut(s) 85, 204
BsrI ACTGG 1 cut(s) 23
BssMI GATC 1 cut(s) 238
Bst2UI CCWGG 1 cut(s) 72
BstC8I GCNNGC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 84
BstENI CCTNNNNNAGG 1 cut(s) 191
BstFNI CGCG 2 cut(s) 237, 284
BstH2I RGCGCY 1 cut(s) 46
BstHHI GCGC 1 cut(s) 45
BstKTI GATC 1 cut(s) 241
BstMBI GATC 1 cut(s) 238
BstNI CCWGG 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 70
BstUI CGCG 2 cut(s) 237, 284
BtuMI TCGCGA 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 222
CfoI GCGC 1 cut(s) 45
Cfr13I GGNCC 2 cut(s) 184, 209
CviJI RGCY 2 cut(s) 55, 297
CviKI_1 RGCY 2 cut(s) 55, 297
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
Eco47I GGWCC 2 cut(s) 184, 209
EcoNI CCTNNNNNAGG 1 cut(s) 191
EcoO109I RGGNCCY 2 cut(s) 184, 209
EcoRII CCWGG 1 cut(s) 70
FaiI YATR 2 cut(s) 147, 177
FalI AAGNNNNNCTT 2 cut(s) 39, 71
GlaI GCGC 1 cut(s) 44
HaeII RGCGCY 1 cut(s) 46
HhaI GCGC 1 cut(s) 45
Hin6I GCGC 1 cut(s) 43
HinP1I GCGC 1 cut(s) 43
HinfI GANTC 1 cut(s) 244
Hpy166II GTNNAC 1 cut(s) 271
Hpy188I TCNGA 2 cut(s) 124, 243
Hpy188III TCNNGA 4 cut(s) 113, 155, 212, 236
Hpy8I GTNNAC 1 cut(s) 271
Hpy99I CGWCG 1 cut(s) 99
HpyAV CCTTC 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 84
HspAI GCGC 1 cut(s) 43
Kzo9I GATC 1 cut(s) 238
LpnPI CCDG 8 cut(s) 36, 57, 84, 126, 168, 206, 210, 225
MaeIII GTNAC 1 cut(s) 167
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MboII GAAGA 1 cut(s) 73
MluCI AATT 4 cut(s) 126, 251, 313, 328
MnlI CCTC 2 cut(s) 25, 197
MseI TTAA 1 cut(s) 29
MspR9I CCNGG 1 cut(s) 72
MvaI CCWGG 1 cut(s) 72
MvnI CGCG 2 cut(s) 237, 284
NdeII GATC 1 cut(s) 238
NlaIV GGNNCC 1 cut(s) 210
NmuCI GTSAC 1 cut(s) 167
NruI TCGCGA 1 cut(s) 237
PfeI GAWTC 1 cut(s) 244
PpuMI RGGWCCY 2 cut(s) 184, 209
Psp5II RGGWCCY 2 cut(s) 184, 209
Psp6I CCWGG 1 cut(s) 70
PspGI CCWGG 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 2 cut(s) 184, 209
PspPPI RGGWCCY 2 cut(s) 184, 209
RruI TCGCGA 1 cut(s) 237
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 1 cut(s) 238
Sau96I GGNCC 2 cut(s) 184, 209
ScrFI CCNGG 1 cut(s) 72
SetI ASST 4 cut(s) 57, 76, 90, 189
SinI GGWCC 2 cut(s) 184, 209
Sse9I AATT 4 cut(s) 126, 251, 313, 328
StyD4I CCNGG 1 cut(s) 70
TasI AATT 4 cut(s) 126, 251, 313, 328
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
VpaK11BI GGWCC 2 cut(s) 184, 209
XagI CCTNNNNNAGG 1 cut(s) 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.