RchiOBHm_Chr1g0373611

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000655
Physical Location & Seq
Reverse (-)
61748842 .. 61750776
1935 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59747

Sequence Viewer

Length: 348 bp
ATGGCTCAATCAAGTTCGGAAGAAACCGACTTGTTCTCCATATTCACTGATTTATTTTTTGAAAAACCAAAACCGAAGAGTACTCCTAGTCAACGTCAGGATGAGCTTGTGAAGAAATTTCCAGGGTCAATGATTATTCGTCGTCCAAATCCAATGGAAGAAGCCGATGATTCAACTTACATTAAATTTCCAGAACATGACTGCGGGAATTATATGGAAAGATTCTATGAGGCGCGTCTTTACGGGAAGGATTGTAGGATTGATAAAACTAGTTGCGTGCATCAAAGAATAATACGCAAGAGTTGTGGTATTGAAGTTTATTACTCTGCAGATAAGTTAAAGATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

13.5

Weight (kDa)

6.73

Isoelectric Point (pI)

48.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 235
AciI CCGC 1 cut(s) 204
AcsI RAATTY 2 cut(s) 116, 185
AfaI GTAC 1 cut(s) 82
AgsI TTSAA 3 cut(s) 62, 174, 314
AhlI ACTAGT 1 cut(s) 269
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
ApoI RAATTY 2 cut(s) 116, 185
AspLEI GCGC 1 cut(s) 235
BciT130I CCWGG 1 cut(s) 123
BcuI ACTAGT 1 cut(s) 269
BfaI CTAG 2 cut(s) 87, 270
BfmI CTRYAG 1 cut(s) 327
BmcAI AGTACT 1 cut(s) 82
Bme1390I CCNGG 1 cut(s) 123
BmrFI CCNGG 1 cut(s) 123
BmsI GCATC 1 cut(s) 289
BsaJI CCNNGG 1 cut(s) 122
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 122
BseGI GGATG 1 cut(s) 106
Bsh1236I CGCG 1 cut(s) 235
BspACI CCGC 1 cut(s) 204
BspFNI CGCG 1 cut(s) 235
BspMAI CTGCAG 1 cut(s) 331
BssECI CCNNGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 123
Bst6I CTCTTC 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 278
BstF5I GGATG 1 cut(s) 106
BstFNI CGCG 1 cut(s) 235
BstHHI GCGC 1 cut(s) 235
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 327
BstUI CGCG 1 cut(s) 235
BtsCI GGATG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 278
CfoI GCGC 1 cut(s) 235
CseI GACGC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 81
CspCI CAANNNNNGTGG 2 cut(s) 286, 321
CviAII CATG 1 cut(s) 197
CviJI RGCY 3 cut(s) 5, 106, 164
CviKI_1 RGCY 3 cut(s) 5, 106, 164
CviQI GTAC 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 71
EarI CTCTTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 200
FaiI YATR 5 cut(s) 41, 198, 213, 215, 228
FatI CATG 1 cut(s) 196
FauI CCCGC 1 cut(s) 197
FokI GGATG 1 cut(s) 113
FspBI CTAG 2 cut(s) 87, 270
GlaI GCGC 1 cut(s) 234
HgaI GACGC 1 cut(s) 224
HhaI GCGC 1 cut(s) 235
Hin1II CATG 1 cut(s) 200
Hin6I GCGC 1 cut(s) 233
HinP1I GCGC 1 cut(s) 233
HincII GTYRAC 1 cut(s) 92
HindII GTYRAC 1 cut(s) 92
HinfI GANTC 2 cut(s) 170, 222
Hpy166II GTNNAC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 2 cut(s) 98, 191
Hpy8I GTNNAC 1 cut(s) 92
Hpy99I CGWCG 1 cut(s) 144
HpyAV CCTTC 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 2 cut(s) 280, 329
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 1 cut(s) 200
HspAI GCGC 1 cut(s) 233
LpnPI CCDG 4 cut(s) 83, 108, 135, 204
LweI GCATC 1 cut(s) 289
MaeI CTAG 2 cut(s) 87, 270
MaeII ACGT 1 cut(s) 94
MboII GAAGA 4 cut(s) 32, 88, 124, 170
MluCI AATT 3 cut(s) 116, 185, 208
MnlI CCTC 1 cut(s) 223
MseI TTAA 3 cut(s) 183, 338, 346
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MvnI CGCG 1 cut(s) 235
NlaIII CATG 1 cut(s) 200
PfeI GAWTC 2 cut(s) 170, 222
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PstI CTGCAG 1 cut(s) 331
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 3 cut(s) 183, 338, 346
ScaI AGTACT 1 cut(s) 82
ScrFI CCNGG 1 cut(s) 123
SetI ASST 2 cut(s) 97, 108
SfaNI GCATC 1 cut(s) 289
SfcI CTRYAG 1 cut(s) 327
SpeI ACTAGT 1 cut(s) 269
Sse9I AATT 3 cut(s) 116, 185, 208
SsiI CCGC 1 cut(s) 204
SspMI CTAG 2 cut(s) 87, 270
StyD4I CCNGG 1 cut(s) 121
TaiI ACGT 1 cut(s) 97
TasI AATT 3 cut(s) 116, 185, 208
TatI WGTACW 1 cut(s) 80
TfiI GAWTC 2 cut(s) 170, 222
Tru1I TTAA 3 cut(s) 183, 338, 346
Tru9I TTAA 3 cut(s) 183, 338, 346
TscAI CASTG 1 cut(s) 52
TspRI CASTG 1 cut(s) 52
XapI RAATTY 2 cut(s) 116, 185
XspI CTAG 2 cut(s) 87, 270
ZrmI AGTACT 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.