Rw5G033670

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
57309753 .. 57312344
2592 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G033670.1

Sequence Viewer

Length: 429 bp
ATGGGGATGGATGCTGTATTTCTGAAGAATTGGGTGTGTACTTTTGCTTCACCACCTGTTCTTGATGTTATGAAAAAGGTGGAAATGCATGTGGTTGTCGTTCCTCCATCTGTTGTTATGGATGAGGATGTGACTATTCAGGAGCTAGCTTCTCTTTCTAGGAAGAAACAGAAAGATGAACTTGTGAAGAAATTCCCTGGGTCAAAAATTATTCGCCGTCCAAATCCAATGGAAGAAGCCGATGATTCACCTTACATTAAGTTTCCAAACCATAATTGCGAGAATTATATGAGAAGACTATATGAGGCAGTGAGAATTTACGGGAAGGATTATTGTGAGATGGATTACAATAGTCGCGTATATCAACGAATAGTACGCCAGGACTGTGGTATTGAAATTCACCCTGCAGATGAGTTAAAGAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

16.6

Weight (kDa)

5.96

Isoelectric Point (pI)

55.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 357
AcsI RAATTY 3 cut(s) 191, 315, 396
AcuI CTGAAG 1 cut(s) 44
AfaI GTAC 2 cut(s) 40, 375
AgsI TTSAA 1 cut(s) 395
AjnI CCWGG 2 cut(s) 196, 378
AluBI AGCT 2 cut(s) 145, 149
AluI AGCT 2 cut(s) 145, 149
ApoI RAATTY 3 cut(s) 191, 315, 396
Asp700I GAANNNNTTC 1 cut(s) 191
AsuHPI GGTGA 3 cut(s) 42, 240, 392
AsuNHI GCTAGC 1 cut(s) 145
BarI GAAGNNNNNNTAC 2 cut(s) 31, 63
BbsI GAAGAC 1 cut(s) 301
BccI CCATC 2 cut(s) 115, 334
BceAI ACGGC 1 cut(s) 201
BciT130I CCWGG 2 cut(s) 198, 380
BfaI CTAG 2 cut(s) 146, 159
BfmI CTRYAG 1 cut(s) 405
Bme1390I CCNGG 2 cut(s) 198, 380
BmrFI CCNGG 2 cut(s) 198, 380
BmtI GCTAGC 1 cut(s) 149
BpiI GAAGAC 1 cut(s) 301
BsaJI CCNNGG 2 cut(s) 196, 197
BseBI CCWGG 2 cut(s) 198, 380
BseDI CCNNGG 2 cut(s) 196, 197
BseGI GGATG 4 cut(s) 12, 16, 127, 133
Bsh1236I CGCG 1 cut(s) 357
BspFNI CGCG 1 cut(s) 357
BspMAI CTGCAG 1 cut(s) 409
BspOI GCTAGC 1 cut(s) 149
BssECI CCNNGG 2 cut(s) 196, 197
Bst2UI CCWGG 2 cut(s) 198, 380
Bst4CI ACNGT 1 cut(s) 386
BstC8I GCNNGC 1 cut(s) 147
BstF5I GGATG 4 cut(s) 12, 16, 127, 133
BstFNI CGCG 1 cut(s) 357
BstNI CCWGG 2 cut(s) 198, 380
BstNSI RCATGY 1 cut(s) 92
BstSCI CCNGG 2 cut(s) 196, 378
BstSFI CTRYAG 1 cut(s) 405
BstUI CGCG 1 cut(s) 357
BstV2I GAAGAC 1 cut(s) 301
BstXI CCANNNNNNTGG 1 cut(s) 386
BtsCI GGATG 4 cut(s) 12, 16, 127, 133
BtsI GCAGTG 1 cut(s) 315
BtsIMutI CAGTG 1 cut(s) 315
Cac8I GCNNGC 1 cut(s) 147
Csp6I GTAC 2 cut(s) 39, 374
CviAII CATG 1 cut(s) 89
CviJI RGCY 3 cut(s) 145, 149, 239
CviKI_1 RGCY 3 cut(s) 145, 149, 239
CviQI GTAC 2 cut(s) 39, 374
Eco57I CTGAAG 1 cut(s) 44
EcoRII CCWGG 2 cut(s) 196, 378
EcoT22I ATGCAT 1 cut(s) 90
FaeI CATG 1 cut(s) 92
FaiI YATR 9 cut(s) 71, 90, 119, 273, 288, 290, 301, 303, 361
FalI AAGNNNNNCTT 2 cut(s) 165, 197
FatI CATG 1 cut(s) 88
FokI GGATG 4 cut(s) 19, 23, 134, 140
FspBI CTAG 2 cut(s) 146, 159
Hin1II CATG 1 cut(s) 92
HinfI GANTC 1 cut(s) 245
HphI GGTGA 3 cut(s) 42, 240, 392
Hpy166II GTNNAC 1 cut(s) 39
Hpy188I TCNGA 1 cut(s) 24
Hpy188III TCNNGA 2 cut(s) 62, 140
Hpy8I GTNNAC 1 cut(s) 39
HpyAV CCTTC 1 cut(s) 319
HpyCH4III ACNGT 1 cut(s) 386
HpyCH4V TGCA 2 cut(s) 88, 407
Hsp92II CATG 1 cut(s) 92
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 7 cut(s) 69, 125, 183, 210, 365, 392, 417
MaeI CTAG 2 cut(s) 146, 159
MaeIII GTNAC 1 cut(s) 130
MboII GAAGA 5 cut(s) 37, 175, 199, 245, 306
MluCI AATT 7 cut(s) 28, 191, 207, 274, 283, 315, 396
MnlI CCTC 3 cut(s) 114, 118, 298
Mph1103I ATGCAT 1 cut(s) 90
MroXI GAANNNNTTC 1 cut(s) 191
MseI TTAA 2 cut(s) 258, 416
MspR9I CCNGG 2 cut(s) 198, 380
MvaI CCWGG 2 cut(s) 198, 380
MvnI CGCG 1 cut(s) 357
NheI GCTAGC 1 cut(s) 145
NlaIII CATG 1 cut(s) 92
NmuCI GTSAC 1 cut(s) 130
NsiI ATGCAT 1 cut(s) 90
NspI RCATGY 1 cut(s) 92
PasI CCCWGGG 1 cut(s) 197
PdmI GAANNNNTTC 1 cut(s) 191
PfeI GAWTC 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 196, 378
PspGI CCWGG 2 cut(s) 196, 378
PstI CTGCAG 1 cut(s) 409
RsaI GTAC 2 cut(s) 40, 375
RsaNI GTAC 2 cut(s) 39, 374
SaqAI TTAA 2 cut(s) 258, 416
ScrFI CCNGG 2 cut(s) 198, 380
SetI ASST 5 cut(s) 58, 81, 147, 151, 253
SfcI CTRYAG 1 cut(s) 405
Sse9I AATT 7 cut(s) 28, 191, 207, 274, 283, 315, 396
SspMI CTAG 2 cut(s) 146, 159
StyD4I CCNGG 2 cut(s) 196, 378
TaaI ACNGT 1 cut(s) 386
TasI AATT 7 cut(s) 28, 191, 207, 274, 283, 315, 396
TatI WGTACW 1 cut(s) 38
TfiI GAWTC 1 cut(s) 245
Tru1I TTAA 2 cut(s) 258, 416
Tru9I TTAA 2 cut(s) 258, 416
TscAI CASTG 1 cut(s) 315
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
TspDTI ATGAA 2 cut(s) 86, 192
TspRI CASTG 1 cut(s) 315
XapI RAATTY 3 cut(s) 191, 315, 396
XceI RCATGY 1 cut(s) 92
XmnI GAANNNNTTC 1 cut(s) 191
XspI CTAG 2 cut(s) 146, 159
Zsp2I ATGCAT 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.