RchiOBHm_Chr1g0374041

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000655
Physical Location & Seq
Forward (+)
62001313 .. 62002755
1443 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59787

Sequence Viewer

Length: 249 bp
ATGGGTCTTTCGCCCTCCCTTCCAGCATTAACTCGTAGTCAGCGACAAGATGAGCTTGTGAAGATGTGTCCAGGTGGCAATGCTAAGGTTACTCGTCGTCCAAAAACAAATCCAGATGGGTCTGAAATTGTTTGCAGAACAGATTATGAGTTTCCTGATTTGATTTGTGACAAATTTATCAAGGACCTCTACAAGGGAAGCCAGGGTCTGAATACCTTTGCGATCAGTCGTAAACAGATCAATGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.18

Weight (kDa)

8.91

Isoelectric Point (pI)

56.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 173
AfiI CCNNNNNNNGG 1 cut(s) 193
AjnI CCWGG 2 cut(s) 70, 201
AluBI AGCT 1 cut(s) 55
AluI AGCT 1 cut(s) 55
AlwNI CAGNNNCTG 1 cut(s) 208
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 184
AvaII GGWCC 1 cut(s) 184
BccI CCATC 1 cut(s) 110
BciT130I CCWGG 2 cut(s) 72, 203
Bme1390I CCNGG 2 cut(s) 72, 203
Bme18I GGWCC 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 184
BmrFI CCNGG 2 cut(s) 72, 203
Bpu10I CCTNAGC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 202
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse3DI GCAATG 1 cut(s) 85
BseBI CCWGG 2 cut(s) 72, 203
BseDI CCNNGG 1 cut(s) 202
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMI GCAATG 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 193
Bsp143I GATC 2 cut(s) 222, 237
BsrDI GCAATG 1 cut(s) 85
BssECI CCNNGG 1 cut(s) 202
BssMI GATC 2 cut(s) 222, 237
Bst2UI CCWGG 2 cut(s) 72, 203
BstDEI CTNAG 1 cut(s) 84
BstENI CCTNNNNNAGG 1 cut(s) 191
BstKTI GATC 2 cut(s) 225, 240
BstMBI GATC 2 cut(s) 222, 237
BstNI CCWGG 2 cut(s) 72, 203
BstSCI CCNGG 2 cut(s) 70, 201
CaiI CAGNNNCTG 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 184
CviJI RGCY 2 cut(s) 55, 201
CviKI_1 RGCY 2 cut(s) 55, 201
DdeI CTNAG 1 cut(s) 84
DpnI GATC 2 cut(s) 224, 239
DpnII GATC 2 cut(s) 222, 237
Eco47I GGWCC 1 cut(s) 184
EcoNI CCTNNNNNAGG 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 184
EcoRII CCWGG 2 cut(s) 70, 201
FaiI YATR 1 cut(s) 147
FalI AAGNNNNNCTT 2 cut(s) 39, 71
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 2 cut(s) 124, 210
Hpy188III TCNNGA 2 cut(s) 113, 155
Hpy8I GTNNAC 1 cut(s) 233
Hpy99I CGWCG 1 cut(s) 99
HpyAV CCTTC 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 84
Kzo9I GATC 2 cut(s) 222, 237
LpnPI CCDG 7 cut(s) 36, 57, 84, 126, 168, 188, 215
MaeIII GTNAC 2 cut(s) 88, 167
MalI GATC 2 cut(s) 224, 239
MboI GATC 2 cut(s) 222, 237
MboII GAAGA 1 cut(s) 73
MluCI AATT 2 cut(s) 126, 173
MnlI CCTC 2 cut(s) 25, 197
MseI TTAA 1 cut(s) 29
MspR9I CCNGG 2 cut(s) 72, 203
MvaI CCWGG 2 cut(s) 72, 203
NdeII GATC 2 cut(s) 222, 237
NmuCI GTSAC 1 cut(s) 167
PcsI WCGNNNNNNNCGW 1 cut(s) 40
PpuMI RGGWCCY 1 cut(s) 184
Psp5II RGGWCCY 1 cut(s) 184
Psp6I CCWGG 2 cut(s) 70, 201
PspGI CCWGG 2 cut(s) 70, 201
PspPI GGNCC 1 cut(s) 184
PspPPI RGGWCCY 1 cut(s) 184
PstNI CAGNNNCTG 1 cut(s) 208
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 2 cut(s) 222, 237
Sau96I GGNCC 1 cut(s) 184
ScrFI CCNGG 2 cut(s) 72, 203
SetI ASST 5 cut(s) 57, 76, 90, 189, 218
SinI GGWCC 1 cut(s) 184
Sse9I AATT 2 cut(s) 126, 173
StyD4I CCNGG 2 cut(s) 70, 201
TasI AATT 2 cut(s) 126, 173
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
VpaK11BI GGWCC 1 cut(s) 184
XagI CCTNNNNNAGG 1 cut(s) 191
XapI RAATTY 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.