FvH4_3g22050

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
15112975 .. 15115244
2270 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g22050.t1

Sequence Viewer

Length: 399 bp
ATGGGGCTTTTCGGTTCCGATTCCGGCTCCAATTCAGGTTCACTTTTCTGTCGCCGTTCCAAAGGTCTTAGTGAAGTTGAAGATGAGCTTGTCAAGAAATATCCTCCAGGTGCTGTGGTTATACTGACCAGAACTCCGTTGAAATCACCTGAAGATTTCATGGGGAACAATTGGAGGCGGAAATCTCGATATGCTTCTTGTGAGAAATGGATTGAAAAGTTCTACGAGGAGCACTCTGCACTTGAAAATGTCACAATAATCATCTTGACGAAGAATGATGCTAGACGTTATCAGGGTCCTCAAAGAAATTGTCCTATATGGTCCAAGATAGGGATTGTGGCATGTGGTCTTGAGGTGTACCCTGAGAAGCTATTGAATGACAAAACTGGAACTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

14.9

Weight (kDa)

8.91

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 171
AfaI GTAC 1 cut(s) 359
AfiI CCNNNNNNNGG 1 cut(s) 330
AgsI TTSAA 5 cut(s) 80, 142, 215, 245, 376
AjnI CCWGG 1 cut(s) 106
AluBI AGCT 3 cut(s) 88, 370, 396
AluI AGCT 3 cut(s) 88, 370, 396
Alw21I GWGCWC 1 cut(s) 234
AlwNI CAGNNNCTG 1 cut(s) 113
ArsI GACNNNNNNTTYG 2 cut(s) 295, 327
AspS9I GGNCC 2 cut(s) 296, 321
AsuHPI GGTGA 1 cut(s) 138
AvaII GGWCC 2 cut(s) 296, 321
Bbv12I GWGCWC 1 cut(s) 234
BceAI ACGGC 1 cut(s) 39
BciT130I CCWGG 1 cut(s) 108
BfaI CTAG 3 cut(s) 282, 393, 397
Bme1390I CCNGG 1 cut(s) 108
Bme18I GGWCC 2 cut(s) 296, 321
BmgT120I GGNCC 2 cut(s) 296, 321
BmiI GGNNCC 3 cut(s) 16, 28, 297
BmrFI CCNGG 1 cut(s) 108
BmsI GCATC 1 cut(s) 268
BplI GAGNNNNNCTC 2 cut(s) 218, 250
BpmI CTGGAG 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 371
BsaXI ACNNNNNCTCC 2 cut(s) 118, 148
Bsc4I CCNNNNNNNGG 1 cut(s) 330
Bse1I ACTGG 1 cut(s) 391
BseBI CCWGG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 330
BseMII CTCAG 1 cut(s) 354
BseNI ACTGG 1 cut(s) 391
BseRI GAGGAG 1 cut(s) 242
BsgI GTGCAG 1 cut(s) 222
BsiHKAI GWGCWC 1 cut(s) 234
BsiSI CCGG 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 330
Bsp1286I GDGCHC 1 cut(s) 234
BspACI CCGC 1 cut(s) 178
BspCNI CTCAG 1 cut(s) 355
BspLI GGNNCC 3 cut(s) 16, 28, 297
BsrI ACTGG 1 cut(s) 391
Bst2UI CCWGG 1 cut(s) 108
BstDEI CTNAG 2 cut(s) 68, 363
BstNI CCWGG 1 cut(s) 108
BstNSI RCATGY 1 cut(s) 345
BstSCI CCNGG 1 cut(s) 106
CaiI CAGNNNCTG 1 cut(s) 113
Cfr13I GGNCC 2 cut(s) 296, 321
Csp6I GTAC 1 cut(s) 358
CviAII CATG 2 cut(s) 160, 342
CviJI RGCY 5 cut(s) 7, 27, 88, 370, 396
CviKI_1 RGCY 5 cut(s) 7, 27, 88, 370, 396
CviQI GTAC 1 cut(s) 358
DdeI CTNAG 2 cut(s) 68, 363
EciI GGCGGA 1 cut(s) 193
Eco47I GGWCC 2 cut(s) 296, 321
Eco57I CTGAAG 1 cut(s) 171
EcoO109I RGGNCCY 1 cut(s) 296
EcoRII CCWGG 1 cut(s) 106
FaeI CATG 2 cut(s) 163, 345
FaiI YATR 6 cut(s) 122, 161, 192, 317, 319, 343
FalI AAGNNNNNCTT 2 cut(s) 72, 104
FatI CATG 2 cut(s) 159, 341
FspBI CTAG 3 cut(s) 282, 393, 397
GsuI CTGGAG 1 cut(s) 90
HapII CCGG 1 cut(s) 24
Hin1II CATG 2 cut(s) 163, 345
HinfI GANTC 1 cut(s) 20
HpaII CCGG 1 cut(s) 24
HphI GGTGA 1 cut(s) 138
Hpy166II GTNNAC 2 cut(s) 41, 358
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 4 cut(s) 94, 186, 265, 350
Hpy8I GTNNAC 2 cut(s) 41, 358
HpyCH4IV ACGT 1 cut(s) 286
HpyCH4V TGCA 1 cut(s) 239
HpyF3I CTNAG 2 cut(s) 68, 363
HpySE526I ACGT 1 cut(s) 286
Hsp92II CATG 2 cut(s) 163, 345
LmnI GCTCC 2 cut(s) 32, 229
LpnPI CCDG 9 cut(s) 21, 37, 93, 120, 142, 162, 278, 372, 375
LweI GCATC 1 cut(s) 268
MaeI CTAG 3 cut(s) 282, 393, 397
MaeII ACGT 1 cut(s) 286
MaeIII GTNAC 1 cut(s) 250
MboII GAAGA 3 cut(s) 92, 164, 283
MfeI CAATTG 1 cut(s) 169
MhlI GDGCHC 1 cut(s) 234
MluCI AATT 3 cut(s) 31, 169, 307
MnlI CCTC 5 cut(s) 114, 168, 220, 309, 346
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 108
MunI CAATTG 1 cut(s) 169
MvaI CCWGG 1 cut(s) 108
NlaIII CATG 2 cut(s) 163, 345
NlaIV GGNNCC 3 cut(s) 16, 28, 297
NmuCI GTSAC 1 cut(s) 250
NspI RCATGY 1 cut(s) 345
PfeI GAWTC 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 296
Psp5II RGGWCCY 1 cut(s) 296
Psp6I CCWGG 1 cut(s) 106
PspGI CCWGG 1 cut(s) 106
PspN4I GGNNCC 3 cut(s) 16, 28, 297
PspPI GGNCC 2 cut(s) 296, 321
PspPPI RGGWCCY 1 cut(s) 296
PstNI CAGNNNCTG 1 cut(s) 113
RsaI GTAC 1 cut(s) 359
RsaNI GTAC 1 cut(s) 358
Sau96I GGNCC 2 cut(s) 296, 321
ScrFI CCNGG 1 cut(s) 108
SduI GDGCHC 1 cut(s) 234
SetI ASST 9 cut(s) 40, 67, 90, 112, 151, 289, 357, 372, 398
SfaNI GCATC 1 cut(s) 268
SinI GGWCC 2 cut(s) 296, 321
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
Sse9I AATT 3 cut(s) 31, 169, 307
SsiI CCGC 1 cut(s) 178
SspMI CTAG 3 cut(s) 282, 393, 397
StyD4I CCNGG 1 cut(s) 106
TaiI ACGT 1 cut(s) 289
TaqI TCGA 1 cut(s) 187
TasI AATT 3 cut(s) 31, 169, 307
TfiI GAWTC 1 cut(s) 20
TseFI GTSAC 1 cut(s) 250
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 1 cut(s) 148
TspGWI ACGGA 1 cut(s) 126
VpaK11BI GGWCC 2 cut(s) 296, 321
XceI RCATGY 1 cut(s) 345
XspI CTAG 3 cut(s) 282, 393, 397
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.