Rw1G034740

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
62650841 .. 62652934
2094 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G034740.1

Sequence Viewer

Length: 369 bp
ATGGCTCAATCAAGTTCGGAAGAATCCGACTTGTTCTCCATATTCACTGATTTATTTTTTGAAAAACCAAAACCACAATCCCAACCAAAACCGAAGAGTACTCCTAGTCAACGTCAGCATGAGCTTGTGAAGAAATTTCCAGGGTCAAAGATTATTCGTCGTCCAAATCCAATGGAAGAAGCCGATGATTCAACTTACATTAAATTTCCAGAACATGACTGCGGGAATTATATGGAAAGATTCTATGAGGCAGCGCGTCTTTACGGGAAGGATTGTAGGATTGATAAAACTAGTTGCGTGCATCAAAGAATAATACGCAAGAGTTGTGGTATTGAAGTTTATTACCCTGCAGATAAGTTAAAGATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

14.26

Weight (kDa)

8.64

Isoelectric Point (pI)

56.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 256
AciI CCGC 1 cut(s) 222
AcsI RAATTY 2 cut(s) 134, 203
AfaI GTAC 1 cut(s) 100
AgsI TTSAA 3 cut(s) 62, 192, 335
AhlI ACTAGT 1 cut(s) 290
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 251
ApoI RAATTY 2 cut(s) 134, 203
AspLEI GCGC 1 cut(s) 256
BbvI GCAGC 1 cut(s) 263
BciT130I CCWGG 1 cut(s) 141
BcuI ACTAGT 1 cut(s) 290
BfaI CTAG 2 cut(s) 105, 291
BfmI CTRYAG 1 cut(s) 348
BisI GCNGC 1 cut(s) 252
BlsI GCNGC 1 cut(s) 253
BmcAI AGTACT 1 cut(s) 100
Bme1390I CCNGG 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 141
BmsI GCATC 1 cut(s) 310
BsaJI CCNNGG 1 cut(s) 140
BsaXI ACNNNNNCTCC 2 cut(s) 20, 50
BseBI CCWGG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 140
BseXI GCAGC 1 cut(s) 263
Bsh1236I CGCG 1 cut(s) 256
BspACI CCGC 1 cut(s) 222
BspFNI CGCG 1 cut(s) 256
BspMAI CTGCAG 1 cut(s) 352
BssECI CCNNGG 1 cut(s) 140
Bst2UI CCWGG 1 cut(s) 141
Bst6I CTCTTC 1 cut(s) 89
BstC8I GCNNGC 1 cut(s) 299
BstFNI CGCG 1 cut(s) 256
BstHHI GCGC 1 cut(s) 256
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BstSFI CTRYAG 1 cut(s) 348
BstUI CGCG 1 cut(s) 256
BstV1I GCAGC 1 cut(s) 263
BtsIMutI CAGTG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 299
CfoI GCGC 1 cut(s) 256
CseI GACGC 1 cut(s) 245
Csp6I GTAC 1 cut(s) 99
CspCI CAANNNNNGTGG 2 cut(s) 307, 342
CviAII CATG 2 cut(s) 119, 215
CviJI RGCY 3 cut(s) 5, 124, 182
CviKI_1 RGCY 3 cut(s) 5, 124, 182
CviQI GTAC 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 139
FaeI CATG 2 cut(s) 122, 218
FaiI YATR 6 cut(s) 41, 120, 216, 231, 233, 246
FatI CATG 2 cut(s) 118, 214
FauI CCCGC 1 cut(s) 215
Fnu4HI GCNGC 1 cut(s) 252
Fsp4HI GCNGC 1 cut(s) 252
FspBI CTAG 2 cut(s) 105, 291
GlaI GCGC 1 cut(s) 255
GluI GCNGC 1 cut(s) 252
HgaI GACGC 1 cut(s) 245
HhaI GCGC 1 cut(s) 256
Hin1II CATG 2 cut(s) 122, 218
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HinfI GANTC 3 cut(s) 23, 188, 240
Hpy166II GTNNAC 1 cut(s) 110
Hpy188I TCNGA 2 cut(s) 19, 28
Hpy188III TCNNGA 1 cut(s) 209
Hpy8I GTNNAC 1 cut(s) 110
Hpy99I CGWCG 1 cut(s) 162
HpyAV CCTTC 1 cut(s) 262
HpyCH4IV ACGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 301, 350
HpySE526I ACGT 1 cut(s) 112
Hsp92II CATG 2 cut(s) 122, 218
HspAI GCGC 1 cut(s) 254
LpnPI CCDG 4 cut(s) 126, 153, 222, 360
Lsp1109I GCAGC 1 cut(s) 263
LweI GCATC 1 cut(s) 310
MaeI CTAG 2 cut(s) 105, 291
MaeII ACGT 1 cut(s) 112
MboII GAAGA 4 cut(s) 32, 106, 142, 188
MluCI AATT 3 cut(s) 134, 203, 226
MmeI TCCRAC 1 cut(s) 51
MnlI CCTC 1 cut(s) 241
MseI TTAA 3 cut(s) 201, 359, 367
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
MvnI CGCG 1 cut(s) 256
NlaIII CATG 2 cut(s) 122, 218
PfeI GAWTC 3 cut(s) 23, 188, 240
PkrI GCNGC 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PstI CTGCAG 1 cut(s) 352
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
SaqAI TTAA 3 cut(s) 201, 359, 367
SatI GCNGC 1 cut(s) 252
ScaI AGTACT 1 cut(s) 100
ScrFI CCNGG 1 cut(s) 141
SetI ASST 2 cut(s) 115, 126
SfaNI GCATC 1 cut(s) 310
SfcI CTRYAG 1 cut(s) 348
SpeI ACTAGT 1 cut(s) 290
Sse9I AATT 3 cut(s) 134, 203, 226
SsiI CCGC 1 cut(s) 222
SspMI CTAG 2 cut(s) 105, 291
StyD4I CCNGG 1 cut(s) 139
TaiI ACGT 1 cut(s) 115
TasI AATT 3 cut(s) 134, 203, 226
TatI WGTACW 1 cut(s) 98
TfiI GAWTC 3 cut(s) 23, 188, 240
Tru1I TTAA 3 cut(s) 201, 359, 367
Tru9I TTAA 3 cut(s) 201, 359, 367
TscAI CASTG 1 cut(s) 52
TseI GCWGC 1 cut(s) 251
TspRI CASTG 1 cut(s) 52
XapI RAATTY 2 cut(s) 134, 203
XspI CTAG 2 cut(s) 105, 291
ZrmI AGTACT 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.