Rh1CG367800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
63890948 .. 63892862
1915 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG367800.1

Sequence Viewer

Length: 351 bp
ATGTTACTAGCCTCAACATTTCAGTATAACAACATCAATTCTTGTTTGCATAGTAATGGCTTTATGTATTCTTTCCGATTAGGTCTTAGTGAAGTTCAAGATGAGCTTGTCAAGAAATATCCTCCCGGTGCTGTGGTTATTCTGACTAGAACTCCGTCAAGATCAGCTGATGATTTCAGGTGGGACTATCTCAGGCCGAAATACCGATATCCTACTTGTGAGGAATGGATTGAAAAGTTCTACGAGTACCAACGCTTGTGTGGAAGAAATTGTCCCGTATGGTCCAAGATACAGATTGAGACCTGTGGTCTTGAGGTGTACCCCGAAAAGCTATTGAATGACTCCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

116

Amino Acids

13.74

Weight (kDa)

6.56

Isoelectric Point (pI)

56.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 248, 320
AgsI TTSAA 3 cut(s) 98, 233, 337
AhdI GACNNNNNGTC 1 cut(s) 306
AluBI AGCT 3 cut(s) 106, 167, 331
AluI AGCT 3 cut(s) 106, 167, 331
Alw26I GTCTC 1 cut(s) 293
AoxI GGCC 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 282
AsuC2I CCSGG 1 cut(s) 126
AvaII GGWCC 1 cut(s) 282
BcnI CCSGG 1 cut(s) 126
BcoDI GTCTC 1 cut(s) 293
BfaI CTAG 2 cut(s) 8, 147
Bme1390I CCNGG 1 cut(s) 126
Bme18I GGWCC 1 cut(s) 282
BmeRI GACNNNNNGTC 1 cut(s) 306
BmgT120I GGNCC 1 cut(s) 282
BmrFI CCNGG 1 cut(s) 126
BpuEI CTTGAG 1 cut(s) 332
BpuMI CCSGG 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 293
BsaXI ACNNNNNCTCC 2 cut(s) 136, 166
BseMII CTCAG 1 cut(s) 205
BshFI GGCC 1 cut(s) 196
BsiSI CCGG 1 cut(s) 126
BslFI GGGAC 2 cut(s) 197, 258
BsmAI GTCTC 1 cut(s) 293
BsmFI GGGAC 2 cut(s) 197, 258
BsnI GGCC 1 cut(s) 196
Bso31I GGTCTC 1 cut(s) 293
Bsp143I GATC 1 cut(s) 161
BspANI GGCC 1 cut(s) 196
BspCNI CTCAG 1 cut(s) 204
BspTNI GGTCTC 1 cut(s) 293
BssMI GATC 1 cut(s) 161
BstDEI CTNAG 2 cut(s) 86, 191
BstKTI GATC 1 cut(s) 164
BstMAI GTCTC 1 cut(s) 293
BstMBI GATC 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 124
BsuRI GGCC 1 cut(s) 196
Cfr13I GGNCC 1 cut(s) 282
Csp6I GTAC 2 cut(s) 247, 319
CviJI RGCY 6 cut(s) 11, 60, 106, 167, 196, 331
CviKI_1 RGCY 6 cut(s) 11, 60, 106, 167, 196, 331
CviQI GTAC 2 cut(s) 247, 319
DdeI CTNAG 2 cut(s) 86, 191
DpnI GATC 1 cut(s) 163
DpnII GATC 1 cut(s) 161
DriI GACNNNNNGTC 1 cut(s) 306
Eam1105I GACNNNNNGTC 1 cut(s) 306
Eco31I GGTCTC 1 cut(s) 293
Eco32I GATATC 1 cut(s) 209
Eco47I GGWCC 1 cut(s) 282
EcoRV GATATC 1 cut(s) 209
FaiI YATR 4 cut(s) 27, 51, 65, 280
FalI AAGNNNNNCTT 2 cut(s) 90, 122
FaqI GGGAC 2 cut(s) 197, 258
FspBI CTAG 2 cut(s) 8, 147
HaeIII GGCC 1 cut(s) 196
HapII CCGG 1 cut(s) 126
HinfI GANTC 1 cut(s) 341
HpaII CCGG 1 cut(s) 126
Hpy166II GTNNAC 1 cut(s) 319
Hpy188I TCNGA 2 cut(s) 77, 144
Hpy188III TCNNGA 4 cut(s) 98, 112, 159, 311
Hpy8I GTNNAC 1 cut(s) 319
HpyCH4V TGCA 1 cut(s) 49
HpyF3I CTNAG 2 cut(s) 86, 191
Kzo9I GATC 1 cut(s) 161
LpnPI CCDG 4 cut(s) 139, 163, 178, 316
MaeI CTAG 2 cut(s) 8, 147
MaeIII GTNAC 1 cut(s) 3
MalI GATC 1 cut(s) 163
MboI GATC 1 cut(s) 161
MboII GAAGA 1 cut(s) 276
MluCI AATT 2 cut(s) 37, 268
MlyI GAGTC 1 cut(s) 335
MnlI CCTC 4 cut(s) 22, 132, 214, 307
MslI CAYNNNNRTG 1 cut(s) 54
MspA1I CMGCKG 1 cut(s) 167
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 1 cut(s) 126
NciI CCSGG 1 cut(s) 126
NdeII GATC 1 cut(s) 161
PleI GAGTC 1 cut(s) 335
PpsI GAGTC 1 cut(s) 335
PspPI GGNCC 1 cut(s) 282
PvuII CAGCTG 1 cut(s) 167
RsaI GTAC 2 cut(s) 248, 320
RsaNI GTAC 2 cut(s) 247, 319
RseI CAYNNNNRTG 1 cut(s) 54
Sau3AI GATC 1 cut(s) 161
Sau96I GGNCC 1 cut(s) 282
SchI GAGTC 1 cut(s) 335
ScrFI CCNGG 1 cut(s) 126
SetI ASST 7 cut(s) 85, 108, 169, 182, 305, 318, 333
SinI GGWCC 1 cut(s) 282
SmiMI CAYNNNNRTG 1 cut(s) 54
SmlI CTYRAG 1 cut(s) 311
SmoI CTYRAG 1 cut(s) 311
Sse9I AATT 2 cut(s) 37, 268
SspMI CTAG 2 cut(s) 8, 147
StyD4I CCNGG 1 cut(s) 124
TasI AATT 2 cut(s) 37, 268
TspGWI ACGGA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 282
XcmI CCANNNNNNNNNTGG 1 cut(s) 257
XspI CTAG 2 cut(s) 8, 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.