RchiOBHm_Chr1g0373961

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000655
Physical Location & Seq
Reverse (-)
61935550 .. 61936374
825 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59779

Sequence Viewer

Length: 189 bp
ATGGGTCTCTTGGTGAATGGTGATGAATATCCGTATGAGGCCTGCCAAAGATATCTCGATTACCTTTATGATGCAACACGTTTGTGTGGGAGCGATTGTACCAGTGCTGTAGCAACTTGCAGTCTCGTAGAGGACTTTTGTGGTATTAAGGTGTTACCTGATGAGTTAGAGAAGAAGGAAGGCCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.91

Weight (kDa)

4.27

Isoelectric Point (pI)

21.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 77
AleI CACNNNNGTG 1 cut(s) 82
Alw26I GTCTC 2 cut(s) 11, 128
AoxI GGCC 2 cut(s) 39, 181
AsuHPI GGTGA 2 cut(s) 25, 32
BcoDI GTCTC 2 cut(s) 11, 128
BfmI CTRYAG 1 cut(s) 108
BmsI GCATC 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 27
BsaI GGTCTC 1 cut(s) 11
BsaXI ACNNNNNCTCC 2 cut(s) 82, 112
Bse1I ACTGG 1 cut(s) 102
Bse8I GATNNNNATC 1 cut(s) 27
BseJI GATNNNNATC 1 cut(s) 27
BseNI ACTGG 1 cut(s) 102
BshFI GGCC 2 cut(s) 41, 183
BsmAI GTCTC 2 cut(s) 11, 128
BsnI GGCC 2 cut(s) 41, 183
Bso31I GGTCTC 1 cut(s) 11
BspANI GGCC 2 cut(s) 41, 183
BspTNI GGTCTC 1 cut(s) 11
BsrI ACTGG 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 43
BstMAI GTCTC 2 cut(s) 11, 128
BstSFI CTRYAG 1 cut(s) 108
BsuRI GGCC 2 cut(s) 41, 183
BtsIMutI CAGTG 2 cut(s) 109, 184
Cac8I GCNNGC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 99
CviJI RGCY 2 cut(s) 41, 183
CviKI_1 RGCY 2 cut(s) 41, 183
CviQI GTAC 1 cut(s) 99
Eco147I AGGCCT 1 cut(s) 41
Eco31I GGTCTC 1 cut(s) 11
Eco32I GATATC 1 cut(s) 53
EcoRV GATATC 1 cut(s) 53
FaiI YATR 2 cut(s) 36, 69
HaeIII GGCC 2 cut(s) 41, 183
HphI GGTGA 2 cut(s) 25, 32
Hpy188III TCNNGA 1 cut(s) 56
HpyAV CCTTC 2 cut(s) 169, 173
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 2 cut(s) 74, 120
HpySE526I ACGT 1 cut(s) 79
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 3 cut(s) 55, 115, 171
LweI GCATC 1 cut(s) 61
MaeII ACGT 1 cut(s) 79
MaeIII GTNAC 1 cut(s) 153
MboII GAAGA 1 cut(s) 184
MnlI CCTC 2 cut(s) 31, 124
MseI TTAA 1 cut(s) 147
MslI CAYNNNNRTG 1 cut(s) 82
OliI CACNNNNGTG 1 cut(s) 82
PceI AGGCCT 1 cut(s) 41
RsaI GTAC 1 cut(s) 100
RsaNI GTAC 1 cut(s) 99
RseI CAYNNNNRTG 1 cut(s) 82
SaqAI TTAA 1 cut(s) 147
SetI ASST 4 cut(s) 66, 82, 153, 160
SfaNI GCATC 1 cut(s) 61
SfcI CTRYAG 1 cut(s) 108
SgeI CNNG 8 cut(s) 22, 54, 68, 90, 114, 129, 137, 170
SmiMI CAYNNNNRTG 1 cut(s) 82
SseBI AGGCCT 1 cut(s) 41
StuI AGGCCT 1 cut(s) 41
TaiI ACGT 1 cut(s) 82
TaqI TCGA 1 cut(s) 57
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 1 cut(s) 39
TspGWI ACGGA 1 cut(s) 21
TspRI CASTG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.