FvH4_4g02851

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0000672
Physical Location & Seq
Reverse (-)
2546402 .. 2546727
326 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g02851.t1

Sequence Viewer

Length: 231 bp
ATGGAATTCAAACTTCTCAATCCTCTAGCAAAACCTCACCCTCAAACCCAAATCTCAAATGGCCTCACTACTCAACCACCGAACATTCCCGACTACCTCGACAACATCCTCTGCTTCATCCAACCCAAGTTAATCGTGGCTCCGATGAAGCGCCGACTTCACCTAGTCGCGCCTAGCCCAAGACCGCCTTGGACGCGCTTGCTTTGCCTTGACGGCGCCTTGACCACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.57

Weight (kDa)

9.59

Isoelectric Point (pI)

49.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 215
AccII CGCG 2 cut(s) 170, 196
AciI CCGC 1 cut(s) 185
AcsI RAATTY 1 cut(s) 5
AcyI GRCGYC 1 cut(s) 216
AgsI TTSAA 1 cut(s) 10
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 5
AspLEI GCGC 4 cut(s) 153, 172, 198, 218
AsuHPI GGTGA 2 cut(s) 29, 152
BanI GGYRCC 1 cut(s) 215
BceAI ACGGC 1 cut(s) 229
BfaI CTAG 4 cut(s) 26, 164, 174, 229
BfoI RGCGCY 2 cut(s) 154, 219
BglI GCCNNNNNGGC 1 cut(s) 213
BmiI GGNNCC 2 cut(s) 141, 217
BsaHI GRCGYC 1 cut(s) 216
BsaJI CCNNGG 1 cut(s) 188
BseDI CCNNGG 1 cut(s) 188
BseGI GGATG 2 cut(s) 105, 117
Bsh1236I CGCG 2 cut(s) 170, 196
BshFI GGCC 1 cut(s) 63
BshNI GGYRCC 1 cut(s) 215
BsnI GGCC 1 cut(s) 63
BspACI CCGC 1 cut(s) 185
BspANI GGCC 1 cut(s) 63
BspFNI CGCG 2 cut(s) 170, 196
BspLI GGNNCC 2 cut(s) 141, 217
BspT107I GGYRCC 1 cut(s) 215
BssECI CCNNGG 1 cut(s) 188
BssNI GRCGYC 1 cut(s) 216
BssT1I CCWWGG 1 cut(s) 188
BstACI GRCGYC 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 200
BstF5I GGATG 2 cut(s) 105, 117
BstFNI CGCG 2 cut(s) 170, 196
BstH2I RGCGCY 2 cut(s) 154, 219
BstHHI GCGC 4 cut(s) 153, 172, 198, 218
BstMWI GCNNNNNNNGC 3 cut(s) 193, 204, 213
BstUI CGCG 2 cut(s) 170, 196
BsuRI GGCC 1 cut(s) 63
BtsCI GGATG 2 cut(s) 105, 117
Cac8I GCNNGC 1 cut(s) 200
CfoI GCGC 4 cut(s) 153, 172, 198, 218
CseI GACGC 1 cut(s) 202
CviJI RGCY 3 cut(s) 63, 140, 177
CviKI_1 RGCY 3 cut(s) 63, 140, 177
DinI GGCGCC 1 cut(s) 217
Eco130I CCWWGG 1 cut(s) 188
EcoRI GAATTC 1 cut(s) 5
EcoT14I CCWWGG 1 cut(s) 188
EgeI GGCGCC 1 cut(s) 217
EheI GGCGCC 1 cut(s) 217
ErhI CCWWGG 1 cut(s) 188
FalI AAGNNNNNCTT 2 cut(s) 172, 204
FokI GGATG 2 cut(s) 92, 104
FspBI CTAG 4 cut(s) 26, 164, 174, 229
GlaI GCGC 4 cut(s) 152, 171, 197, 217
HaeII RGCGCY 2 cut(s) 154, 219
HaeIII GGCC 1 cut(s) 63
HgaI GACGC 1 cut(s) 202
HhaI GCGC 4 cut(s) 153, 172, 198, 218
Hin1I GRCGYC 1 cut(s) 216
Hin6I GCGC 4 cut(s) 151, 170, 196, 216
HinP1I GCGC 4 cut(s) 151, 170, 196, 216
HphI GGTGA 2 cut(s) 29, 152
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 1 cut(s) 89
HpyF10VI GCNNNNNNNGC 3 cut(s) 193, 204, 213
Hsp92I GRCGYC 1 cut(s) 216
HspAI GCGC 4 cut(s) 151, 170, 196, 216
KasI GGCGCC 1 cut(s) 215
LmnI GCTCC 1 cut(s) 145
MaeI CTAG 4 cut(s) 26, 164, 174, 229
MluCI AATT 1 cut(s) 5
Mly113I GGCGCC 1 cut(s) 216
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 6 cut(s) 33, 45, 51, 74, 107, 119
MseI TTAA 1 cut(s) 131
MvnI CGCG 2 cut(s) 170, 196
MwoI GCNNNNNNNGC 3 cut(s) 193, 204, 213
NarI GGCGCC 1 cut(s) 216
NlaIV GGNNCC 2 cut(s) 141, 217
PluTI GGCGCC 1 cut(s) 219
PspN4I GGNNCC 2 cut(s) 141, 217
SaqAI TTAA 1 cut(s) 131
SetI ASST 4 cut(s) 37, 99, 165, 230
SfoI GGCGCC 1 cut(s) 217
Sse9I AATT 1 cut(s) 5
SsiI CCGC 1 cut(s) 185
SspDI GGCGCC 1 cut(s) 215
SspMI CTAG 4 cut(s) 26, 164, 174, 229
StyI CCWWGG 1 cut(s) 188
TaqI TCGA 1 cut(s) 99
TasI AATT 1 cut(s) 5
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TspDTI ATGAA 2 cut(s) 106, 161
XapI RAATTY 1 cut(s) 5
XcmI CCANNNNNNNNNTGG 3 cut(s) 56, 133, 186
XspI CTAG 4 cut(s) 26, 164, 174, 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.