Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8483409.1

Orthogroup ID

OG0000672

Physical Location & Seq

Genomic Coordinates Reverse (-)

313 .. 1119

Gene Structure 807 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8483409.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 807 bp

atgaccaccaccgtcaccggaagccgtgaatctccgcatgagagacgcaatatttccaccgtagtttaccaagaccatataaaccaatccttcacaagcagcgccggcgtggacgtacttccgatcagattccggctctttaaggtaactgctaactataatccgattctccacgattatgatctcgaaactccaattcccatatctacacatgtatatttgctgcggttctcggcggagtggcggagctggaattcaaagataacgatggagaggttggctaggtatcataggacgattgctaagtgtggttggcagatggataagttggtagacaagctggcaatgtatctttctgatactgtgggtgttgaagaggatcaacacccttgtactattctgaaaacggtggagatgattcaagccgccgtctacgaccgggttatcgatgtgcagatatctgacatcacatttatcgaaccggaacctgaaccggaggaggaatctgagctggaggaggagtctgaaccggaggaggagtcggaacaagaggagtctgaaacggaggaggattctgaacaggagggattcgaggatttggacgacacatcgtacggggacaatctgactcctgcatctgaatcattcatggaggatttgaagaaattgagagtacttggttcggaattggaaatgcttgggcagacgccaaactgtgctatttgtctggaggtgcttgctgaagaaggatatgaccattactcgtttgccttgcttacactattatcatcgggattgcattattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

IQ zf-RING_2

Protein Analysis

268

Amino Acids

30.73

Weight (kDa)

4.32

Isoelectric Point (pI)

63.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000672)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g16160 FvH4_2g35510 FvH4_2g35780 FvH4_2g35800 FvH4_2g35820 FvH4_2g37001 FvH4_2g37010 FvH4_3g15631 FvH4_4g02851 FvH4_4g04350 FvH4_5g02800 FvH4_5g20841 FvH4_6g04371 FvH4_6g05080 FvH4_6g05110 FvH4_6g05110 FvH4_6g11150 FvH4_6g30701 FvH4_7g27701
rosa_chinensis	RchiOBHm_Chr3g0484371 RchiOBHm_Chr3g0484461 RchiOBHm_Chr6g0305991 RchiOBHm_Chr6g0306361
rosa_laevigata	RLG00000010804 RLG00000010834 RLG00000010836 RLG00000023229 RLG00000025652
rosa_multiflora	Rmu_co8287559.1_g000001 Rmu_co8483409.1_g000001 Rmu_sc0000295.1_g000021 Rmu_sc0001809.1_g000061 Rmu_sc0003473.1_g000008 Rmu_sc0007821.1_g000008 Rmu_sc0020534.1_g000003 Rmu_sc0020534.1_g000004 Rmu_sc0031367.1_g000001
rosa_roxburghii	Rroxscaffold_7G00162150 Rroxscaffold_7G00182610 Rroxscaffold_7G00210990
rosa_rugosa	Rorug02G0635600 Rorug04G0038100 Rorug06G0177500 Rorug06G0345900 Rorug06G0346000.1 Rorug06G0346100.1 Rorug06G0348400 Rorug06G0348500 Rorug06G0352200
rosa_samantha	Rh3AG037500 Rh3AG260200 Rh6AG067600 Rh6AG457900 Rh6BG060700 Rh6BG291400 Rh6BG442900 Rh6BG443200 Rh6CG060600 Rh6CG472600 Rh6DG458600 Rh6DG461800 Rh6DG465500 Rh7AG428600
rosa_wichuraiana	Rw3G023500 Rw5G004660 Rw6G005950 Rw6G039940 Rw6G040170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	333, 432
AciI	CCGC	5 cut(s)	35, 226, 236, 244, 426
AclWI	GGATC	1 cut(s)	387
AcsI	RAATTY	1 cut(s)	253
AcuI	CTGAAG	1 cut(s)	762
AcyI	GRCGYC	1 cut(s)	707
AfaI	GTAC	4 cut(s)	117, 394, 614, 675
AflIII	ACRYGT	1 cut(s)	211
AgsI	TTSAA	4 cut(s)	258, 374, 422, 661
AluBI	AGCT	3 cut(s)	249, 340, 511
AluI	AGCT	3 cut(s)	249, 340, 511
Alw26I	GTCTC	1 cut(s)	37
AlwI	GGATC	1 cut(s)	387
ApeKI	GCWGC	2 cut(s)	99, 223
ApoI	RAATTY	1 cut(s)	253
AspLEI	GCGC	1 cut(s)	104
AsuC2I	CCSGG	1 cut(s)	440
AsuHPI	GGTGA	1 cut(s)	7
BbvI	GCAGC	2 cut(s)	111, 210
BccI	CCATC	2 cut(s)	262, 313
BceAI	ACGGC	2 cut(s)	9, 413
BcnI	CCSGG	1 cut(s)	440
BcoDI	GTCTC	1 cut(s)	37
BfaI	CTAG	1 cut(s)	282
BfoI	RGCGCY	1 cut(s)	105
BisI	GCNGC	3 cut(s)	100, 224, 426
BlsI	GCNGC	3 cut(s)	101, 225, 427
BmcAI	AGTACT	1 cut(s)	675
Bme1390I	CCNGG	1 cut(s)	440
BmiI	GGNNCC	1 cut(s)	486
BmrFI	CCNGG	1 cut(s)	440
BmsI	GCATC	1 cut(s)	644
BpmI	CTGGAG	2 cut(s)	533, 749
BpuMI	CCSGG	1 cut(s)	440
Bsa29I	ATCGAT	1 cut(s)	447
BsaBI	GATNNNNATC	1 cut(s)	180
BsaHI	GRCGYC	1 cut(s)	707
BsaWI	WCCGGW	4 cut(s)	17, 481, 493, 529
BsaXI	ACNNNNNCTCC	4 cut(s)	506, 524, 536, 554
Bse118I	RCCGGY	1 cut(s)	104
Bse3DI	GCAATG	1 cut(s)	351
Bse8I	GATNNNNATC	1 cut(s)	180
BseCI	ATCGAT	1 cut(s)	447
BseJI	GATNNNNATC	1 cut(s)	180
BseMI	GCAATG	1 cut(s)	351
BseMII	CTCAG	1 cut(s)	498
BseRI	GAGGAG	7 cut(s)	512, 530, 533, 548, 551, 566, 581
BseXI	GCAGC	2 cut(s)	111, 210
BsgI	GTGCAG	1 cut(s)	473
Bsh1285I	CGRYCG	1 cut(s)	439
BshVI	ATCGAT	1 cut(s)	447
BsiEI	CGRYCG	1 cut(s)	439
BsiSI	CCGG	7 cut(s)	18, 105, 133, 439, 482, 494, 530
BsiWI	CGTACG	1 cut(s)	612
BslFI	GGGAC	1 cut(s)	632
BsmAI	GTCTC	1 cut(s)	37
BsmBI	CGTCTC	1 cut(s)	37
BsmFI	GGGAC	1 cut(s)	632
Bsp143I	GATC	3 cut(s)	123, 181, 379
BspACI	CCGC	5 cut(s)	35, 226, 236, 244, 426
BspCNI	CTCAG	1 cut(s)	499
BspDI	ATCGAT	1 cut(s)	447
BspLI	GGNNCC	1 cut(s)	486
BspPI	GGATC	1 cut(s)	387
BsrDI	GCAATG	1 cut(s)	351
BsrFI	RCCGGY	1 cut(s)	104
BssAI	RCCGGY	1 cut(s)	104
BssMI	GATC	3 cut(s)	123, 181, 379
BssNI	GRCGYC	1 cut(s)	707
Bst4CI	ACNGT	5 cut(s)	13, 61, 364, 409, 716
Bst6I	CTCTTC	1 cut(s)	369
BstACI	GRCGYC	1 cut(s)	707
BstC8I	GCNNGC	3 cut(s)	106, 342, 738
BstDEI	CTNAG	2 cut(s)	303, 507
BstH2I	RGCGCY	1 cut(s)	105
BstHHI	GCGC	1 cut(s)	104
BstKTI	GATC	3 cut(s)	126, 184, 382
BstMAI	GTCTC	1 cut(s)	37
BstMBI	GATC	3 cut(s)	123, 181, 379
BstMCI	CGRYCG	1 cut(s)	439
BstMWI	GCNNNNNNNGC	1 cut(s)	105
BstNSI	RCATGY	1 cut(s)	215
BstSCI	CCNGG	1 cut(s)	438
BstV1I	GCAGC	2 cut(s)	111, 210
Bsu15I	ATCGAT	1 cut(s)	447
BsuTUI	ATCGAT	1 cut(s)	447
Cac8I	GCNNGC	3 cut(s)	106, 342, 738
CfoI	GCGC	1 cut(s)	104
Cfr10I	RCCGGY	1 cut(s)	104
ClaI	ATCGAT	1 cut(s)	447
CseI	GACGC	2 cut(s)	54, 715
Csp6I	GTAC	4 cut(s)	116, 393, 613, 674
CviAII	CATG	3 cut(s)	38, 212, 649
CviJI	RGCY	7 cut(s)	24, 136, 249, 281, 340, 425, 511
CviKI_1	RGCY	7 cut(s)	24, 136, 249, 281, 340, 425, 511
CviQI	GTAC	4 cut(s)	116, 393, 613, 674
DdeI	CTNAG	2 cut(s)	303, 507
DpnI	GATC	3 cut(s)	125, 183, 381
DpnII	GATC	3 cut(s)	123, 181, 379
Eam1104I	CTCTTC	1 cut(s)	369
EarI	CTCTTC	1 cut(s)	369
EciI	GGCGGA	2 cut(s)	251, 259
Eco32I	GATATC	1 cut(s)	459
Eco57I	CTGAAG	1 cut(s)	762
EcoRI	GAATTC	1 cut(s)	253
EcoRV	GATATC	1 cut(s)	459
Esp3I	CGTCTC	1 cut(s)	37
FaeI	CATG	3 cut(s)	41, 215, 652
FaqI	GGGAC	1 cut(s)	632
FatI	CATG	3 cut(s)	37, 211, 648
FblI	GTMKAC	2 cut(s)	333, 432
Fnu4HI	GCNGC	3 cut(s)	100, 224, 426
Fsp4HI	GCNGC	3 cut(s)	100, 224, 426
FspBI	CTAG	1 cut(s)	282
GlaI	GCGC	1 cut(s)	103
GluI	GCNGC	3 cut(s)	100, 224, 426
GsuI	CTGGAG	2 cut(s)	533, 749
HaeII	RGCGCY	1 cut(s)	105
HapII	CCGG	7 cut(s)	18, 105, 133, 439, 482, 494, 530
HgaI	GACGC	2 cut(s)	54, 715
HhaI	GCGC	1 cut(s)	104
Hin1I	GRCGYC	1 cut(s)	707
Hin1II	CATG	3 cut(s)	41, 215, 652
Hin6I	GCGC	1 cut(s)	102
HinP1I	GCGC	1 cut(s)	102
HpaII	CCGG	7 cut(s)	18, 105, 133, 439, 482, 494, 530
HphI	GGTGA	1 cut(s)	7
Hpy166II	GTNNAC	4 cut(s)	67, 112, 334, 433
Hpy188III	TCNNGA	3 cut(s)	185, 728, 792
Hpy8I	GTNNAC	4 cut(s)	67, 112, 334, 433
HpyAV	CCTTC	2 cut(s)	100, 740
HpyCH4III	ACNGT	5 cut(s)	13, 61, 364, 409, 716
HpyCH4IV	ACGT	1 cut(s)	114
HpyCH4V	TGCA	3 cut(s)	454, 635, 799
HpyF10VI	GCNNNNNNNGC	1 cut(s)	105
HpyF3I	CTNAG	2 cut(s)	303, 507
HpySE526I	ACGT	1 cut(s)	114
Hsp92I	GRCGYC	1 cut(s)	707
Hsp92II	CATG	3 cut(s)	41, 215, 652
HspAI	GCGC	1 cut(s)	102
KroI	GCCGGC	1 cut(s)	104
KroNI	GCCGGC	1 cut(s)	106
Kzo9I	GATC	3 cut(s)	123, 181, 379
LmnI	GCTCC	1 cut(s)	246
Lsp1109I	GCAGC	2 cut(s)	111, 210
LweI	GCATC	1 cut(s)	644
MaeI	CTAG	1 cut(s)	282
MaeII	ACGT	1 cut(s)	114
MaeIII	GTNAC	2 cut(s)	13, 145
MalI	GATC	3 cut(s)	125, 183, 381
MboI	GATC	3 cut(s)	123, 181, 379
MboII	GAAGA	3 cut(s)	386, 673, 755
MluCI	AATT	4 cut(s)	195, 253, 665, 686
MlyI	GAGTC	4 cut(s)	530, 548, 563, 622
MmeI	TCCRAC	1 cut(s)	522
MreI	CGCCGGCG	1 cut(s)	104
MroNI	GCCGGC	1 cut(s)	104
MseI	TTAA	2 cut(s)	141, 805
MslI	CAYNNNNRTG	1 cut(s)	177
MspI	CCGG	7 cut(s)	18, 105, 133, 439, 482, 494, 530
MspR9I	CCNGG	1 cut(s)	440
MwoI	GCNNNNNNNGC	1 cut(s)	105
NaeI	GCCGGC	1 cut(s)	106
NciI	CCSGG	1 cut(s)	440
NdeII	GATC	3 cut(s)	123, 181, 379
NgoMIV	GCCGGC	1 cut(s)	104
NlaIII	CATG	3 cut(s)	41, 215, 652
NlaIV	GGNNCC	1 cut(s)	486
NmeAIII	GCCGAG	1 cut(s)	212
NmuCI	GTSAC	1 cut(s)	13
NspI	RCATGY	1 cut(s)	215
PciI	ACATGT	1 cut(s)	211
PdiI	GCCGGC	1 cut(s)	106
PfeI	GAWTC	8 cut(s)	29, 129, 166, 418, 503, 572, 588, 641
Pfl23II	CGTACG	1 cut(s)	612
PkrI	GCNGC	3 cut(s)	101, 225, 427
PleI	GAGTC	4 cut(s)	529, 547, 562, 622
PpsI	GAGTC	4 cut(s)	529, 547, 562, 622
PscI	ACATGT	1 cut(s)	211
PspLI	CGTACG	1 cut(s)	612
PspN4I	GGNNCC	1 cut(s)	486
RsaI	GTAC	4 cut(s)	117, 394, 614, 675
RsaNI	GTAC	4 cut(s)	116, 393, 613, 674
RseI	CAYNNNNRTG	1 cut(s)	177
SaqAI	TTAA	2 cut(s)	141, 805
SatI	GCNGC	3 cut(s)	100, 224, 426
Sau3AI	GATC	3 cut(s)	123, 181, 379
ScaI	AGTACT	1 cut(s)	675
SchI	GAGTC	4 cut(s)	530, 548, 563, 622
ScrFI	CCNGG	1 cut(s)	440
SetI	ASST	9 cut(s)	117, 147, 251, 278, 287, 342, 490, 513, 735
SfaNI	GCATC	1 cut(s)	644
SgrAI	CRCCGGYG	1 cut(s)	104
SmiMI	CAYNNNNRTG	1 cut(s)	177
Sse9I	AATT	4 cut(s)	195, 253, 665, 686
SsiI	CCGC	5 cut(s)	35, 226, 236, 244, 426
SspI	AATATT	1 cut(s)	52
SspMI	CTAG	1 cut(s)	282
StyD4I	CCNGG	1 cut(s)	438
TaaI	ACNGT	5 cut(s)	13, 61, 364, 409, 716
TaiI	ACGT	1 cut(s)	117
TaqI	TCGA	4 cut(s)	186, 447, 477, 591
TasI	AATT	4 cut(s)	195, 253, 665, 686
TatI	WGTACW	2 cut(s)	392, 673
TauI	GCSGC	1 cut(s)	428
TfiI	GAWTC	8 cut(s)	29, 129, 166, 418, 503, 572, 588, 641
Tru1I	TTAA	2 cut(s)	141, 805
Tru9I	TTAA	2 cut(s)	141, 805
TseFI	GTSAC	1 cut(s)	13
TseI	GCWGC	2 cut(s)	99, 223
Tsp45I	GTSAC	1 cut(s)	13
TspDTI	ATGAA	1 cut(s)	637
TspGWI	ACGGA	1 cut(s)	578
XapI	RAATTY	1 cut(s)	253
XceI	RCATGY	1 cut(s)	215
XmiI	GTMKAC	2 cut(s)	333, 432
XspI	CTAG	1 cut(s)	282
ZrmI	AGTACT	1 cut(s)	675

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.