Rh7AG428600

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
57614661 .. 57614990
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG428600.1

Sequence Viewer

Length: 330 bp
ATGGAGAGACTTGCTAGGTATCAAAGGGTCATAGCTGGGTCTCCCAGGGGAGCGAACAAGTTACGGAGCAAGTTGGGTAAGTACCTTACCACAACTGTGGGAATTCACCAAAATGAGCAATCGTTTATTATTGAACAAATATTGGAAACGCTCCAAAAAGCCGATAAAATTATAGAAGTGCACTTGATAGAAATTACATTTAGAAGTACGAATTGGTCCTTTCTGTGGGGCTTCGACGATATATACTACAGGGCTAAACTATTATCATCGACATTGCATTGTCCACTGGCTCCAGATCAATCATGTCTGTACCACTCGTCGACACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.57

Weight (kDa)

9.0

Isoelectric Point (pI)

60.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 320
AcsI RAATTY 1 cut(s) 102
AfaI GTAC 3 cut(s) 83, 208, 311
AfiI CCNNNNNNNGG 1 cut(s) 225
AgsI TTSAA 1 cut(s) 134
AjnI CCWGG 1 cut(s) 44
AjuI GAANNNNNNNTTGG 2 cut(s) 196, 228
AleI CACNNNNGTG 1 cut(s) 95
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
Alw21I GWGCWC 1 cut(s) 183
Alw26I GTCTC 1 cut(s) 45
Alw44I GTGCAC 1 cut(s) 179
ApaLI GTGCAC 1 cut(s) 179
ApoI RAATTY 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 98
AvaII GGWCC 1 cut(s) 216
BaeGI GKGCMC 1 cut(s) 183
Bbv12I GWGCWC 1 cut(s) 183
BciT130I CCWGG 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 45
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 247
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 1 cut(s) 291
BmrFI CCNGG 1 cut(s) 46
BpmI CTGGAG 1 cut(s) 276
BsaI GGTCTC 1 cut(s) 45
BsaJI CCNNGG 2 cut(s) 44, 45
Bsc4I CCNNNNNNNGG 1 cut(s) 225
Bse1I ACTGG 1 cut(s) 291
Bse3DI GCAATG 1 cut(s) 272
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 2 cut(s) 44, 45
BseLI CCNNNNNNNGG 1 cut(s) 225
BseMI GCAATG 1 cut(s) 272
BseNI ACTGG 1 cut(s) 291
BseSI GKGCMC 1 cut(s) 183
BseYI CCCAGC 1 cut(s) 35
BsiHKAI GWGCWC 1 cut(s) 183
BslI CCNNNNNNNGG 1 cut(s) 225
BsmAI GTCTC 1 cut(s) 45
Bso31I GGTCTC 1 cut(s) 45
Bsp1286I GDGCHC 1 cut(s) 183
Bsp143I GATC 1 cut(s) 295
BspLI GGNNCC 1 cut(s) 291
BspTNI GGTCTC 1 cut(s) 45
BsrDI GCAATG 1 cut(s) 272
BsrI ACTGG 1 cut(s) 291
BssECI CCNNGG 2 cut(s) 44, 45
BssMI GATC 1 cut(s) 295
Bst2UI CCWGG 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 97
BstKTI GATC 1 cut(s) 298
BstMAI GTCTC 1 cut(s) 45
BstMBI GATC 1 cut(s) 295
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 247
BstSLI GKGCMC 1 cut(s) 183
BstXI CCANNNNNNTGG 1 cut(s) 97
BtsIMutI CAGTG 1 cut(s) 284
Cfr13I GGNCC 1 cut(s) 216
Csp6I GTAC 3 cut(s) 82, 207, 310
CviAII CATG 1 cut(s) 303
CviJI RGCY 5 cut(s) 35, 161, 231, 254, 290
CviKI_1 RGCY 5 cut(s) 35, 161, 231, 254, 290
CviQI GTAC 3 cut(s) 82, 207, 310
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
Eco31I GGTCTC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 216
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 44
FaeI CATG 1 cut(s) 306
FaiI YATR 5 cut(s) 32, 173, 242, 244, 304
FatI CATG 1 cut(s) 302
FblI GTMKAC 1 cut(s) 320
FspBI CTAG 1 cut(s) 15
GsaI CCCAGC 1 cut(s) 39
GsuI CTGGAG 1 cut(s) 276
Hin1II CATG 1 cut(s) 306
HincII GTYRAC 1 cut(s) 321
HindII GTYRAC 1 cut(s) 321
HphI GGTGA 1 cut(s) 98
Hpy166II GTNNAC 3 cut(s) 181, 284, 321
Hpy188III TCNNGA 1 cut(s) 293
Hpy8I GTNNAC 3 cut(s) 181, 284, 321
Hpy99I CGWCG 2 cut(s) 239, 322
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4V TGCA 2 cut(s) 181, 277
Hsp92II CATG 1 cut(s) 306
Kzo9I GATC 1 cut(s) 295
LmnI GCTCC 4 cut(s) 50, 66, 156, 295
LpnPI CCDG 6 cut(s) 21, 31, 58, 235, 272, 306
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 60
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MhlI GDGCHC 1 cut(s) 183
MluCI AATT 4 cut(s) 102, 168, 192, 211
MslI CAYNNNNRTG 2 cut(s) 95, 111
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
NdeII GATC 1 cut(s) 295
NlaIII CATG 1 cut(s) 306
NlaIV GGNNCC 1 cut(s) 291
OliI CACNNNNGTG 1 cut(s) 95
PasI CCCWGGG 1 cut(s) 45
Psp6I CCWGG 1 cut(s) 44
PspFI CCCAGC 1 cut(s) 35
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 291
PspPI GGNCC 1 cut(s) 216
RsaI GTAC 3 cut(s) 83, 208, 311
RsaNI GTAC 3 cut(s) 82, 207, 310
RseI CAYNNNNRTG 2 cut(s) 95, 111
SalI GTCGAC 1 cut(s) 319
Sau3AI GATC 1 cut(s) 295
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 46
SduI GDGCHC 1 cut(s) 183
SetI ASST 3 cut(s) 20, 37, 87
SfcI CTRYAG 1 cut(s) 247
SinI GGWCC 1 cut(s) 216
SmiMI CAYNNNNRTG 2 cut(s) 95, 111
Sse9I AATT 4 cut(s) 102, 168, 192, 211
SspI AATATT 1 cut(s) 141
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 97
TaqI TCGA 3 cut(s) 234, 269, 320
TasI AATT 4 cut(s) 102, 168, 192, 211
TscAI CASTG 1 cut(s) 291
TspGWI ACGGA 1 cut(s) 79
TspRI CASTG 1 cut(s) 291
VneI GTGCAC 1 cut(s) 179
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 1 cut(s) 102
XmiI GTMKAC 1 cut(s) 320
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.