FvH4_6g30701

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
23764262 .. 23764686
425 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g30701.t1

Sequence Viewer

Length: 243 bp
ATGGAATTTGAACTTCCCAATCCTCTCGCAAAACTTCGCCCTCAAACCCAAATCTCAAATGGCCTCACTGCTCAACCATCGGACATTTCCGAAGACCTTGACGATGACAACGTCCTCTGCTTCGCCCAGCCCAAGTTAATCATGGCTCCGATTTCGAGCCTAGTCCAAGACTACCTTGGACACGCCTGCTTCGCCTTGATTGCGCCTTACTTGAACGCTTTGGAGAAAATCCGAGCGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.77

Weight (kDa)

4.41

Isoelectric Point (pI)

41.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 236
AciI CCGC 1 cut(s) 236
AcsI RAATTY 1 cut(s) 5
AgsI TTSAA 2 cut(s) 11, 214
AoxI GGCC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 5
AspLEI GCGC 1 cut(s) 205
BbsI GAAGAC 1 cut(s) 99
BccI CCATC 1 cut(s) 85
BfaI CTAG 1 cut(s) 161
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmiI GGNNCC 1 cut(s) 147
BpiI GAAGAC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 175
BseYI CCCAGC 1 cut(s) 126
BshFI GGCC 1 cut(s) 63
BsnI GGCC 1 cut(s) 63
BspACI CCGC 1 cut(s) 236
BspANI GGCC 1 cut(s) 63
BspLI GGNNCC 1 cut(s) 147
BsrBI CCGCTC 1 cut(s) 236
BssECI CCNNGG 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 187
BstHHI GCGC 1 cut(s) 205
BstMWI GCNNNNNNNGC 2 cut(s) 191, 200
BstV2I GAAGAC 1 cut(s) 99
BsuRI GGCC 1 cut(s) 63
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 187
CfoI GCGC 1 cut(s) 205
CviAII CATG 1 cut(s) 142
CviJI RGCY 5 cut(s) 63, 130, 146, 159, 239
CviKI_1 RGCY 5 cut(s) 63, 130, 146, 159, 239
Eco130I CCWWGG 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 145
FaiI YATR 1 cut(s) 143
FalI AAGNNNNNCTT 2 cut(s) 159, 191
FatI CATG 1 cut(s) 141
Fnu4HI GCNGC 1 cut(s) 237
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 1 cut(s) 161
GlaI GCGC 1 cut(s) 204
GluI GCNGC 1 cut(s) 237
GsaI CCCAGC 1 cut(s) 130
HaeIII GGCC 1 cut(s) 63
HhaI GCGC 1 cut(s) 205
Hin1II CATG 1 cut(s) 145
Hin6I GCGC 1 cut(s) 203
HinP1I GCGC 1 cut(s) 203
Hpy188I TCNGA 4 cut(s) 82, 91, 150, 233
HpyCH4IV ACGT 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 2 cut(s) 191, 200
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 145
HspAI GCGC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 2 cut(s) 140, 199
MaeI CTAG 1 cut(s) 161
MaeII ACGT 1 cut(s) 111
MbiI CCGCTC 1 cut(s) 236
MboII GAAGA 1 cut(s) 104
MluCI AATT 1 cut(s) 5
MnlI CCTC 4 cut(s) 33, 51, 74, 125
MseI TTAA 2 cut(s) 137, 241
MwoI GCNNNNNNNGC 2 cut(s) 191, 200
NlaIII CATG 1 cut(s) 145
NlaIV GGNNCC 1 cut(s) 147
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PflFI GACNNNGTC 1 cut(s) 110
PkrI GCNGC 1 cut(s) 238
PspFI CCCAGC 1 cut(s) 126
PspN4I GGNNCC 1 cut(s) 147
PsyI GACNNNGTC 1 cut(s) 110
SaqAI TTAA 2 cut(s) 137, 241
SatI GCNGC 1 cut(s) 237
SetI ASST 3 cut(s) 99, 114, 177
Sse9I AATT 1 cut(s) 5
SsiI CCGC 1 cut(s) 236
SspMI CTAG 1 cut(s) 161
StyI CCWWGG 1 cut(s) 175
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 155
TasI AATT 1 cut(s) 5
TauI GCSGC 1 cut(s) 239
Tru1I TTAA 2 cut(s) 137, 241
Tru9I TTAA 2 cut(s) 137, 241
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
Tth111I GACNNNGTC 1 cut(s) 110
XapI RAATTY 1 cut(s) 5
XcmI CCANNNNNNNNNTGG 3 cut(s) 56, 139, 173
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.