pycom07g06320

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
5567342 .. 5567711
370 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g06320.1

Sequence Viewer

Length: 306 bp
ATGGCAATCTATCGTGTCGTGGGAAGCTTAAGTCTTGCCAACTGCAATATATCAGAAATTCCTAGTGATCTTGGTTTCTTATCGGCGTTGAAGCATTTGGATCTATCTGCAAACCCAATTCTGAACCTACCAGAAAACATGAAGGATCTTATTATGCTCCAAACTCTGCTGCTAGAAGGTTGCACAATGCTTCAAACACTTCCAGAGCTCCCCTTAAGTTTAACAAGATTGGAAACAGATAAGTACATCATTGAAAAGTTTTTGGTAAACATGAAGGAATTAGTTGAAGCTCAAAGTTTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.38

Weight (kDa)

4.64

Isoelectric Point (pI)

45.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 9 - 61 6e-06 Leucine rich repeat
LRR_14 PF23598 10 - 77 8.2e-08 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000654)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g20301 FvH4_2g20310 FvH4_2g20310 FvH4_2g20700
malus_domestica MD07G1079200.v1.1 MD07G1079300.v1.1 MD07G1079400.v1.1 MD12G1024400.v1.1 MD15G1375000.v1.1 MD15G1375200.v1.1 MD15G1375500.v1.1 MD15G1376100.v1.1 MD15G1376200.v1.1 MD15G1376300.v1.1 MD17G1274300.v1.1 MD17G1275000.v1.1 MD17G1275400.v1.1 MD17G1275900.v1.1 MD17G1276000.v1.1 MD17G1276600.v1.1 MD17G1277700.v1.1
prunus_persica Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.3G009700_v2.0.a1 Prupe.3G010100_v2.0.a1 Prupe.3G010300_v2.0.a1 Prupe.3G130700_v2.0.a1 Prupe.3G130800_v2.0.a1 Prupe.3G130900_v2.0.a1
pyrus_communis pycom07g06290 pycom07g06320 pycom15g33580 pycom15g33620 pycom17g27240 pycom17g27360 pycom17g27390 pycom17g27400 pycom17g27410 pycom17g27450 pycom17g27530
rosa_chinensis RchiOBHm_Chr4g0405381 RchiOBHm_Chr6g0286441
rosa_laevigata RLG00000008845 RLG00000012572
rosa_multiflora Rmu_sc0000575.1_g000003 Rmu_sc0003585.1_g000001 Rmu_sc0027178.1_g000001 Rmu_sc0042065.1_g000001
rosa_roxburghii Rroxscaffold_4G00313580 Rroxscaffold_5G00349860 Rroxscaffold_7G00182360
rosa_rugosa Rorug01G0140300.1 Rorug01G0140400.1 Rorug04G0057900 Rorug04G0057900 Rorug04G0058000 Rorug04G0058100 Rorug04G0058200 Rorug06G0179200 Rorug06G0184100
rosa_samantha Rh4AG131500 Rh4BG126200 Rh4BG126300 Rh4CG138700 Rh4DG125600 Rh6AG292000 Rh6BG295500 Rh6BG300700 Rh6CG296200 Rh6DG288000
rosa_wichuraiana Rw1G013150 Rw1G013160 Rw4G010650 Rw6G025170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 108, 153
AcsI RAATTY 1 cut(s) 57
AfaI GTAC 1 cut(s) 245
AflII CTTAAG 2 cut(s) 28, 214
AgsI TTSAA 4 cut(s) 91, 194, 254, 287
AluBI AGCT 3 cut(s) 27, 208, 290
AluI AGCT 3 cut(s) 27, 208, 290
Alw21I GWGCWC 1 cut(s) 210
AlwI GGATC 2 cut(s) 108, 153
ApeKI GCWGC 1 cut(s) 169
ApoI RAATTY 1 cut(s) 57
BanII GRGCYC 1 cut(s) 210
Bbv12I GWGCWC 1 cut(s) 210
BbvI GCAGC 1 cut(s) 156
BfaI CTAG 2 cut(s) 63, 173
BfrI CTTAAG 2 cut(s) 28, 214
BisI GCNGC 1 cut(s) 170
BlsI GCNGC 1 cut(s) 171
BseXI GCAGC 1 cut(s) 156
BsiHKAI GWGCWC 1 cut(s) 210
Bsp1286I GDGCHC 1 cut(s) 210
Bsp143I GATC 3 cut(s) 67, 100, 145
BspPI GGATC 2 cut(s) 108, 153
BspTI CTTAAG 2 cut(s) 28, 214
BssMI GATC 3 cut(s) 67, 100, 145
BstAFI CTTAAG 2 cut(s) 28, 214
BstKTI GATC 3 cut(s) 70, 103, 148
BstMBI GATC 3 cut(s) 67, 100, 145
BstV1I GCAGC 1 cut(s) 156
BstX2I RGATCY 2 cut(s) 100, 145
BstYI RGATCY 2 cut(s) 100, 145
Csp6I GTAC 1 cut(s) 244
CviAII CATG 2 cut(s) 139, 271
CviJI RGCY 3 cut(s) 27, 208, 290
CviKI_1 RGCY 3 cut(s) 27, 208, 290
CviQI GTAC 1 cut(s) 244
DpnI GATC 3 cut(s) 69, 102, 147
DpnII GATC 3 cut(s) 67, 100, 145
Ecl136II GAGCTC 1 cut(s) 208
Eco24I GRGCYC 1 cut(s) 210
Eco53kI GAGCTC 1 cut(s) 208
EcoICRI GAGCTC 1 cut(s) 208
EcoT38I GRGCYC 1 cut(s) 210
FaeI CATG 2 cut(s) 142, 274
FaiI YATR 4 cut(s) 50, 140, 155, 272
FatI CATG 2 cut(s) 138, 270
Fnu4HI GCNGC 1 cut(s) 170
FriOI GRGCYC 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 170
FspBI CTAG 2 cut(s) 63, 173
GluI GCNGC 1 cut(s) 170
Hin1II CATG 2 cut(s) 142, 274
HindIII AAGCTT 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 2 cut(s) 55, 123
Hpy188III TCNNGA 1 cut(s) 203
Hpy8I GTNNAC 1 cut(s) 268
HpyAV CCTTC 3 cut(s) 136, 170, 268
HpyCH4V TGCA 3 cut(s) 45, 110, 183
Hsp92II CATG 2 cut(s) 142, 274
Kzo9I GATC 3 cut(s) 67, 100, 145
LmnI GCTCC 2 cut(s) 162, 213
LpnPI CCDG 2 cut(s) 144, 216
Lsp1109I GCAGC 1 cut(s) 156
MaeI CTAG 2 cut(s) 63, 173
MalI GATC 3 cut(s) 69, 102, 147
MboI GATC 3 cut(s) 67, 100, 145
MflI RGATCY 2 cut(s) 100, 145
MhlI GDGCHC 1 cut(s) 210
MluCI AATT 3 cut(s) 57, 117, 278
MseI TTAA 3 cut(s) 29, 215, 221
MspCI CTTAAG 2 cut(s) 28, 214
NdeII GATC 3 cut(s) 67, 100, 145
NlaIII CATG 2 cut(s) 142, 274
PkrI GCNGC 1 cut(s) 171
Psp124BI GAGCTC 1 cut(s) 210
PsuI RGATCY 2 cut(s) 100, 145
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
SacI GAGCTC 1 cut(s) 210
SaqAI TTAA 3 cut(s) 29, 215, 221
SatI GCNGC 1 cut(s) 170
Sau3AI GATC 3 cut(s) 67, 100, 145
SduI GDGCHC 1 cut(s) 210
SetI ASST 5 cut(s) 29, 129, 181, 210, 292
SmlI CTYRAG 2 cut(s) 28, 214
SmoI CTYRAG 2 cut(s) 28, 214
Sse9I AATT 3 cut(s) 57, 117, 278
SspMI CTAG 2 cut(s) 63, 173
SstI GAGCTC 1 cut(s) 210
TasI AATT 3 cut(s) 57, 117, 278
TatI WGTACW 1 cut(s) 243
Tru1I TTAA 3 cut(s) 29, 215, 221
Tru9I TTAA 3 cut(s) 29, 215, 221
TseI GCWGC 1 cut(s) 169
TspDTI ATGAA 2 cut(s) 155, 287
Vha464I CTTAAG 2 cut(s) 28, 214
XapI RAATTY 1 cut(s) 57
XspI CTAG 2 cut(s) 63, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.