Rmu_sc0003585.1_g000001

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003585.1
OG0000654
Physical Location & Seq
Forward (+)
18 .. 752
735 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003585.1_g000001.1.cds

Sequence Viewer

Length: 735 bp
atgaaacagggactctatgaatgtggaatatttagcattttcctgcatggaagcacaattcctgactgctacacctacagaagcatgggtgattcagtgttatctataactgttccttcccatcttaagcttaagatccgaggcttaaatgtatgtattctatatgcactaggcccatgccaccaccttaaagtcagtaatgacacgaagggtcttatgtggacatactgcccagtcactgcaggtgttcctaaagaggatggaccgatgctatggctaagtcattggctgtttgagaaccatgagttggaggctggggatgaattacgtgtctcggtgcataatggagctatattctttgaccctcttggtcgtcaagacgttcttccagcaaaggaatttggaatccaacttgtgtatgaatcggaaaataaggacgtccgatccaaaagtgaagatcttacggtacaacatgaagcgccttattggagttacaatattgttactgggaatggatcattgtcagcatcaaagtatcaaatgtggacaggcaaatactttctttgcaattgtgttcacaatatgcgtcagtttcatttcagaaattgcgaggagaatccagctcatcttgatttttcatatgagcccaaagatcgtttgagtggatattgccgtcatttatttgatcacactcactttcacaagaaaaaatttgagtttgtattgaatagatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC TIR

Protein Analysis

244

Amino Acids

28.2

Weight (kDa)

6.72

Isoelectric Point (pI)

29.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000654)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g20301 FvH4_2g20310 FvH4_2g20310 FvH4_2g20700
malus_domestica MD07G1079200.v1.1 MD07G1079300.v1.1 MD07G1079400.v1.1 MD12G1024400.v1.1 MD15G1375000.v1.1 MD15G1375200.v1.1 MD15G1375500.v1.1 MD15G1376100.v1.1 MD15G1376200.v1.1 MD15G1376300.v1.1 MD17G1274300.v1.1 MD17G1275000.v1.1 MD17G1275400.v1.1 MD17G1275900.v1.1 MD17G1276000.v1.1 MD17G1276600.v1.1 MD17G1277700.v1.1
prunus_persica Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.3G009700_v2.0.a1 Prupe.3G010100_v2.0.a1 Prupe.3G010300_v2.0.a1 Prupe.3G130700_v2.0.a1 Prupe.3G130800_v2.0.a1 Prupe.3G130900_v2.0.a1
pyrus_communis pycom07g06290 pycom07g06320 pycom15g33580 pycom15g33620 pycom17g27240 pycom17g27360 pycom17g27390 pycom17g27400 pycom17g27410 pycom17g27450 pycom17g27530
rosa_chinensis RchiOBHm_Chr4g0405381 RchiOBHm_Chr6g0286441
rosa_laevigata RLG00000008845 RLG00000012572
rosa_multiflora Rmu_sc0000575.1_g000003 Rmu_sc0003585.1_g000001 Rmu_sc0027178.1_g000001 Rmu_sc0042065.1_g000001
rosa_roxburghii Rroxscaffold_4G00313580 Rroxscaffold_5G00349860 Rroxscaffold_7G00182360
rosa_rugosa Rorug01G0140300.1 Rorug01G0140400.1 Rorug04G0057900 Rorug04G0057900 Rorug04G0058000 Rorug04G0058100 Rorug04G0058200 Rorug06G0179200 Rorug06G0184100
rosa_samantha Rh4AG131500 Rh4BG126200 Rh4BG126300 Rh4CG138700 Rh4DG125600 Rh6AG292000 Rh6BG295500 Rh6BG300700 Rh6CG296200 Rh6DG288000
rosa_wichuraiana Rw1G013150 Rw1G013160 Rw4G010650 Rw6G025170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 233
AatII GACGTC 1 cut(s) 441
Acc36I ACCTGC 1 cut(s) 233
AccB7I CCANNNNNTGG 1 cut(s) 307
AclWI GGATC 3 cut(s) 130, 438, 523
AcsI RAATTY 2 cut(s) 398, 710
AcyI GRCGYC 1 cut(s) 438
AfaI GTAC 1 cut(s) 468
AfiI CCNNNNNNNGG 1 cut(s) 307
AflII CTTAAG 2 cut(s) 125, 131
AflIII ACRYGT 1 cut(s) 328
AgsI TTSAA 1 cut(s) 727
AjuI GAANNNNNNNTTGG 2 cut(s) 290, 322
AluBI AGCT 3 cut(s) 130, 350, 623
AluI AGCT 3 cut(s) 130, 350, 623
Alw26I GTCTC 1 cut(s) 337
AlwI GGATC 3 cut(s) 130, 438, 523
AlwNI CAGNNNCTG 1 cut(s) 239
AoxI GGCC 1 cut(s) 172
ApoI RAATTY 2 cut(s) 398, 710
AspLEI GCGC 1 cut(s) 481
AspS9I GGNCC 2 cut(s) 173, 263
AsuHPI GGTGA 1 cut(s) 101
AvaII GGWCC 1 cut(s) 263
BanII GRGCYC 1 cut(s) 648
BccI CCATC 2 cut(s) 129, 254
BceAI ACGGC 1 cut(s) 657
BclI TGATCA 1 cut(s) 685
BcoDI GTCTC 1 cut(s) 337
BfaI CTAG 1 cut(s) 170
BfmI CTRYAG 2 cut(s) 76, 240
BfoI RGCGCY 1 cut(s) 482
BfrI CTTAAG 2 cut(s) 125, 131
BfuAI ACCTGC 1 cut(s) 233
BglII AGATCT 1 cut(s) 457
Bme18I GGWCC 1 cut(s) 263
BmgT120I GGNCC 2 cut(s) 173, 263
BmrI ACTGGG 2 cut(s) 227, 516
BmsI GCATC 2 cut(s) 258, 536
BmuI ACTGGG 2 cut(s) 227, 516
BsaAI YACGTR 1 cut(s) 329
BsaHI GRCGYC 1 cut(s) 438
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 307
Bse1I ACTGG 2 cut(s) 233, 511
BseDI CCNNGG 1 cut(s) 139
BseGI GGATG 2 cut(s) 265, 325
BseLI CCNNNNNNNGG 1 cut(s) 307
BseNI ACTGG 2 cut(s) 233, 511
BseRI GAGGAG 1 cut(s) 626
BseYI CCCAGC 1 cut(s) 314
BshFI GGCC 1 cut(s) 174
BslFI GGGAC 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 307
BsmAI GTCTC 1 cut(s) 337
BsmFI GGGAC 1 cut(s) 24
BsnI GGCC 1 cut(s) 174
Bsp1286I GDGCHC 1 cut(s) 648
Bsp143I GATC 6 cut(s) 135, 443, 457, 515, 652, 685
BspANI GGCC 1 cut(s) 174
BspMAI CTGCAG 1 cut(s) 244
BspMI ACCTGC 1 cut(s) 233
BspPI GGATC 3 cut(s) 130, 438, 523
BspTI CTTAAG 2 cut(s) 125, 131
BsrI ACTGG 2 cut(s) 233, 511
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 6 cut(s) 135, 443, 457, 515, 652, 685
BssNI GRCGYC 1 cut(s) 438
Bst4CI ACNGT 2 cut(s) 112, 466
BstACI GRCGYC 1 cut(s) 438
BstAFI CTTAAG 2 cut(s) 125, 131
BstBAI YACGTR 1 cut(s) 329
BstDEI CTNAG 1 cut(s) 278
BstF5I GGATG 2 cut(s) 265, 325
BstH2I RGCGCY 1 cut(s) 482
BstHHI GCGC 1 cut(s) 481
BstKTI GATC 6 cut(s) 138, 446, 460, 518, 655, 688
BstMAI GTCTC 1 cut(s) 337
BstMBI GATC 6 cut(s) 135, 443, 457, 515, 652, 685
BstSFI CTRYAG 2 cut(s) 76, 240
BstX2I RGATCY 2 cut(s) 135, 457
BstYI RGATCY 2 cut(s) 135, 457
BsuRI GGCC 1 cut(s) 174
BtsCI GGATG 2 cut(s) 265, 325
BtsI GCAGTG 1 cut(s) 237
BtsIMutI CAGTG 2 cut(s) 102, 237
BveI ACCTGC 1 cut(s) 233
CaiI CAGNNNCTG 1 cut(s) 239
CfoI GCGC 1 cut(s) 481
Cfr13I GGNCC 2 cut(s) 173, 263
CseI GACGC 1 cut(s) 575
Csp6I GTAC 1 cut(s) 467
CviAII CATG 5 cut(s) 47, 85, 177, 302, 473
CviJI RGCY 9 cut(s) 130, 144, 174, 277, 289, 314, 350, 623, 646
CviKI_1 RGCY 9 cut(s) 130, 144, 174, 277, 289, 314, 350, 623, 646
CviQI GTAC 1 cut(s) 467
DdeI CTNAG 1 cut(s) 278
DpnI GATC 6 cut(s) 137, 445, 459, 517, 654, 687
DpnII GATC 6 cut(s) 135, 443, 457, 515, 652, 685
Eco24I GRGCYC 1 cut(s) 648
Eco47I GGWCC 1 cut(s) 263
EcoT38I GRGCYC 1 cut(s) 648
FaeI CATG 5 cut(s) 50, 88, 180, 305, 476
FalI AAGNNNNNCTT 2 cut(s) 369, 401
FaqI GGGAC 1 cut(s) 24
FatI CATG 5 cut(s) 46, 84, 176, 301, 472
FauNDI CATATG 1 cut(s) 640
FbaI TGATCA 1 cut(s) 685
FokI GGATG 2 cut(s) 272, 332
FriOI GRGCYC 1 cut(s) 648
FspBI CTAG 1 cut(s) 170
GlaI GCGC 1 cut(s) 480
GsaI CCCAGC 1 cut(s) 318
HaeII RGCGCY 1 cut(s) 482
HaeIII GGCC 1 cut(s) 174
HgaI GACGC 1 cut(s) 575
HhaI GCGC 1 cut(s) 481
Hin1I GRCGYC 1 cut(s) 438
Hin1II CATG 5 cut(s) 50, 88, 180, 305, 476
Hin6I GCGC 1 cut(s) 479
HinP1I GCGC 1 cut(s) 479
HindIII AAGCTT 1 cut(s) 128
HinfI GANTC 5 cut(s) 12, 92, 405, 422, 616
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 3 cut(s) 222, 546, 577
Hpy188I TCNGA 4 cut(s) 140, 427, 443, 602
Hpy188III TCNNGA 3 cut(s) 62, 377, 629
Hpy8I GTNNAC 3 cut(s) 222, 546, 577
HpyAV CCTTC 2 cut(s) 126, 202
HpyCH4III ACNGT 2 cut(s) 112, 466
HpyCH4IV ACGT 3 cut(s) 328, 381, 438
HpyCH4V TGCA 5 cut(s) 46, 167, 242, 340, 567
HpyF3I CTNAG 1 cut(s) 278
HpySE526I ACGT 3 cut(s) 328, 381, 438
Hsp92I GRCGYC 1 cut(s) 438
Hsp92II CATG 5 cut(s) 50, 88, 180, 305, 476
HspAI GCGC 1 cut(s) 479
Ksp22I TGATCA 1 cut(s) 685
Kzo9I GATC 6 cut(s) 135, 443, 457, 515, 652, 685
LmnI GCTCC 1 cut(s) 347
LpnPI CCDG 9 cut(s) 56, 75, 228, 246, 300, 402, 492, 534, 633
LweI GCATC 2 cut(s) 258, 536
MaeI CTAG 1 cut(s) 170
MaeII ACGT 3 cut(s) 328, 381, 438
MaeIII GTNAC 3 cut(s) 235, 491, 502
MalI GATC 6 cut(s) 137, 445, 459, 517, 654, 687
MboI GATC 6 cut(s) 135, 443, 457, 515, 652, 685
MboII GAAGA 2 cut(s) 377, 467
MfeI CAATTG 1 cut(s) 568
MflI RGATCY 2 cut(s) 135, 457
MhlI GDGCHC 1 cut(s) 648
MluCI AATT 6 cut(s) 57, 323, 398, 568, 604, 710
MlyI GAGTC 1 cut(s) 6
MmeI TCCRAC 2 cut(s) 288, 433
MnlI CCTC 5 cut(s) 134, 250, 304, 375, 604
MseI TTAA 4 cut(s) 126, 132, 146, 189
MspCI CTTAAG 2 cut(s) 125, 131
MunI CAATTG 1 cut(s) 568
NdeI CATATG 1 cut(s) 640
NdeII GATC 6 cut(s) 135, 443, 457, 515, 652, 685
NlaIII CATG 5 cut(s) 50, 88, 180, 305, 476
NmuCI GTSAC 1 cut(s) 235
PaqCI CACCTGC 1 cut(s) 233
PfeI GAWTC 4 cut(s) 92, 405, 422, 616
PflMI CCANNNNNTGG 1 cut(s) 307
PleI GAGTC 1 cut(s) 6
PpsI GAGTC 1 cut(s) 6
Ppu21I YACGTR 1 cut(s) 329
PspFI CCCAGC 1 cut(s) 314
PspPI GGNCC 2 cut(s) 173, 263
PstI CTGCAG 1 cut(s) 244
PstNI CAGNNNCTG 1 cut(s) 239
PsuI RGATCY 2 cut(s) 135, 457
RsaI GTAC 1 cut(s) 468
RsaNI GTAC 1 cut(s) 467
SaqAI TTAA 4 cut(s) 126, 132, 146, 189
Sau3AI GATC 6 cut(s) 135, 443, 457, 515, 652, 685
Sau96I GGNCC 2 cut(s) 173, 263
SchI GAGTC 1 cut(s) 6
SduI GDGCHC 1 cut(s) 648
SetI ASST 9 cut(s) 77, 132, 189, 247, 331, 352, 384, 441, 625
SfaNI GCATC 2 cut(s) 258, 536
SfcI CTRYAG 2 cut(s) 76, 240
SinI GGWCC 1 cut(s) 263
SmlI CTYRAG 2 cut(s) 125, 131
SmoI CTYRAG 2 cut(s) 125, 131
Sse9I AATT 6 cut(s) 57, 323, 398, 568, 604, 710
SspI AATATT 2 cut(s) 30, 499
SspMI CTAG 1 cut(s) 170
TaaI ACNGT 2 cut(s) 112, 466
TaiI ACGT 3 cut(s) 331, 384, 441
TaqII GACCGA 1 cut(s) 280
TasI AATT 6 cut(s) 57, 323, 398, 568, 604, 710
TfiI GAWTC 4 cut(s) 92, 405, 422, 616
Tru1I TTAA 4 cut(s) 126, 132, 146, 189
Tru9I TTAA 4 cut(s) 126, 132, 146, 189
TscAI CASTG 2 cut(s) 102, 244
TseFI GTSAC 1 cut(s) 235
Tsp45I GTSAC 1 cut(s) 235
TspDTI ATGAA 7 cut(s) 17, 33, 336, 435, 489, 584, 627
TspRI CASTG 2 cut(s) 102, 244
Van91I CCANNNNNTGG 1 cut(s) 307
Vha464I CTTAAG 2 cut(s) 125, 131
VpaK11BI GGWCC 1 cut(s) 263
XapI RAATTY 2 cut(s) 398, 710
XspI CTAG 1 cut(s) 170
ZraI GACGTC 1 cut(s) 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.