Rmu_sc0042065.1_g000001

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042065.1
OG0000654
Physical Location & Seq
Forward (+)
30 .. 1540
1511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042065.1_g000001.1.cds

Sequence Viewer

Length: 1128 bp
atggtagtgccagttttctataaggtggatccatctgttgttaggtggcagattaggagttttgcagatgcatttgccaaacatgaaaagcgcttcaaggaggagatcggcaaggtggacaagtggagaaaagctcttaaagatgtagctgatctaggagggatggtcttaggagatcagtacgaatcacagctcatccaaaatattgttgacgagattgaaaaaaaaatggatcccattacattaaatgtcgctccatatgctgttggaataaacgctcgtgtggaagacctcaacatgtggttaagagatggatcagttgatgttggtgtggctggcatctacgggatgggtggaattggcaagaccactattgctaaagctgcttataatctgaatcgggatagatttgaaggaagaagttttcttgcagatgttagaacaactacagaacaacctaatggtttggttcgcttgcagaggaaccttctttcagatattcaaaggagaaaaacaaaaaagataaacagcgtggatgaaggtacaagcaaaatcaagaatgttgtatgctgcaaaagagtacttattgttcttgatgatgtgaacgacttggaccagttcaatgcgattcttggaatgcgagagtggtttcatccaggaagcaagattatcataacaactagagataaacacttgttaacggctactggggtttctaacatgttcatggttccagaattggatgagcatgaatcacttcagcttttcagttggcatgccttcagacaagctcatcctatagaaggctacatggaggtttcagcactcatagtaaaacactgtggagggctaccgttagccctccaagttctggggtcttctctatttggaaaaagtgtacatgtatggtacagtacattagagaagttagatgtggttcctgatagcaaaattcaaagaattcttagaataagctacgattatctacaagatcatcatgacaaatctttattccttcatattgcatgtttcttcataggaaagaagagaaacttgacatttacagtcagggccggccctgtgagtttagaggctcaaggcgggaaaaaatttgaggccccaaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8 NB-ARC TIR

Protein Analysis

375

Amino Acids

42.38

Weight (kDa)

9.04

Isoelectric Point (pI)

36.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000654)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g20301 FvH4_2g20310 FvH4_2g20310 FvH4_2g20700
malus_domestica MD07G1079200.v1.1 MD07G1079300.v1.1 MD07G1079400.v1.1 MD12G1024400.v1.1 MD15G1375000.v1.1 MD15G1375200.v1.1 MD15G1375500.v1.1 MD15G1376100.v1.1 MD15G1376200.v1.1 MD15G1376300.v1.1 MD17G1274300.v1.1 MD17G1275000.v1.1 MD17G1275400.v1.1 MD17G1275900.v1.1 MD17G1276000.v1.1 MD17G1276600.v1.1 MD17G1277700.v1.1
prunus_persica Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.2G101900_v2.0.a1 Prupe.3G009700_v2.0.a1 Prupe.3G010100_v2.0.a1 Prupe.3G010300_v2.0.a1 Prupe.3G130700_v2.0.a1 Prupe.3G130800_v2.0.a1 Prupe.3G130900_v2.0.a1
pyrus_communis pycom07g06290 pycom07g06320 pycom15g33580 pycom15g33620 pycom17g27240 pycom17g27360 pycom17g27390 pycom17g27400 pycom17g27410 pycom17g27450 pycom17g27530
rosa_chinensis RchiOBHm_Chr4g0405381 RchiOBHm_Chr6g0286441
rosa_laevigata RLG00000008845 RLG00000012572
rosa_multiflora Rmu_sc0000575.1_g000003 Rmu_sc0003585.1_g000001 Rmu_sc0027178.1_g000001 Rmu_sc0042065.1_g000001
rosa_roxburghii Rroxscaffold_4G00313580 Rroxscaffold_5G00349860 Rroxscaffold_7G00182360
rosa_rugosa Rorug01G0140300.1 Rorug01G0140400.1 Rorug04G0057900 Rorug04G0057900 Rorug04G0058000 Rorug04G0058100 Rorug04G0058200 Rorug06G0179200 Rorug06G0184100
rosa_samantha Rh4AG131500 Rh4BG126200 Rh4BG126300 Rh4CG138700 Rh4DG125600 Rh6AG292000 Rh6BG295500 Rh6BG300700 Rh6CG296200 Rh6DG288000
rosa_wichuraiana Rw1G013150 Rw1G013160 Rw4G010650 Rw6G025170

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 390
AccB7I CCANNNNNTGG 1 cut(s) 871
AciI CCGC 1 cut(s) 1101
AclWI GGATC 5 cut(s) 23, 36, 227, 240, 322
AcsI RAATTY 3 cut(s) 951, 960, 1109
AcuI CTGAAG 2 cut(s) 743, 766
AfaI GTAC 6 cut(s) 182, 544, 582, 900, 911, 916
AfeI AGCGCT 1 cut(s) 92
AfiI CCNNNNNNNGG 2 cut(s) 803, 871
AflIII ACRYGT 3 cut(s) 297, 720, 901
AgsI TTSAA 6 cut(s) 97, 221, 413, 503, 622, 956
AjnI CCWGG 1 cut(s) 655
AluBI AGCT 7 cut(s) 134, 149, 193, 383, 763, 791, 975
AluI AGCT 7 cut(s) 134, 149, 193, 383, 763, 791, 975
AlwI GGATC 5 cut(s) 23, 36, 227, 240, 322
Aor51HI AGCGCT 1 cut(s) 92
AoxI GGCC 3 cut(s) 1071, 1075, 1116
ApeKI GCWGC 2 cut(s) 383, 570
ApoI RAATTY 3 cut(s) 951, 960, 1109
Asp700I GAANNNNTTC 1 cut(s) 756
AspLEI GCGC 1 cut(s) 93
AspS9I GGNCC 4 cut(s) 613, 1071, 1076, 1117
AvaII GGWCC 1 cut(s) 613
BamHI GGATCC 2 cut(s) 28, 232
BauI CACGAG 1 cut(s) 279
BbsI GAAGAC 2 cut(s) 294, 870
BbvI GCAGC 2 cut(s) 370, 557
BccI CCATC 4 cut(s) 40, 157, 305, 343
BceAI ACGGC 1 cut(s) 717
BciT130I CCWGG 1 cut(s) 657
BfaI CTAG 2 cut(s) 155, 681
BfmI CTRYAG 2 cut(s) 447, 798
BfoI RGCGCY 1 cut(s) 94
BisI GCNGC 2 cut(s) 384, 571
BlsI GCNGC 2 cut(s) 385, 572
BmcAI AGTACT 1 cut(s) 582
Bme1390I CCNGG 1 cut(s) 657
Bme18I GGWCC 1 cut(s) 613
BmgT120I GGNCC 4 cut(s) 613, 1071, 1076, 1117
BmiI GGNNCC 6 cut(s) 30, 234, 485, 732, 939, 1119
BmrFI CCNGG 1 cut(s) 657
BmrI ACTGGG 1 cut(s) 717
BmsI GCATC 2 cut(s) 58, 348
BmuI ACTGGG 1 cut(s) 717
BpiI GAAGAC 2 cut(s) 294, 870
BplI GAGNNNNNCTC 2 cut(s) 118, 150
BpuEI CTTGAG 1 cut(s) 1080
BsaXI ACNNNNNCTCC 2 cut(s) 150, 180
Bsc4I CCNNNNNNNGG 2 cut(s) 803, 871
Bse118I RCCGGY 1 cut(s) 1073
Bse1I ACTGG 3 cut(s) 11, 616, 712
BseBI CCWGG 1 cut(s) 657
BseGI GGATG 7 cut(s) 168, 195, 354, 541, 652, 748, 793
BseLI CCNNNNNNNGG 2 cut(s) 803, 871
BseNI ACTGG 3 cut(s) 11, 616, 712
BseRI GAGGAG 1 cut(s) 116
BseXI GCAGC 2 cut(s) 370, 557
BshFI GGCC 3 cut(s) 1073, 1077, 1118
BsiSI CCGG 1 cut(s) 1074
BslI CCNNNNNNNGG 2 cut(s) 803, 871
BsmI GAATGC 1 cut(s) 642
BsnI GGCC 3 cut(s) 1073, 1077, 1118
Bsp1407I TGTACA 1 cut(s) 898
Bsp143I GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
BspACI CCGC 1 cut(s) 1101
BspANI GGCC 3 cut(s) 1073, 1077, 1118
BspHI TCATGA 1 cut(s) 997
BspLI GGNNCC 6 cut(s) 30, 234, 485, 732, 939, 1119
BspPI GGATC 5 cut(s) 23, 36, 227, 240, 322
BsrFI RCCGGY 1 cut(s) 1073
BsrGI TGTACA 1 cut(s) 898
BsrI ACTGG 3 cut(s) 11, 616, 712
BssAI RCCGGY 1 cut(s) 1073
BssMI GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
BssSI CACGAG 1 cut(s) 279
Bst2BI CACGAG 1 cut(s) 279
Bst2UI CCWGG 1 cut(s) 657
Bst4CI ACNGT 4 cut(s) 842, 855, 914, 1066
Bst6I CTCTTC 1 cut(s) 1040
BstAUI TGTACA 1 cut(s) 898
BstC8I GCNNGC 4 cut(s) 337, 476, 777, 1075
BstDEI CTNAG 2 cut(s) 169, 965
BstENI CCTNNNNNAGG 1 cut(s) 801
BstF5I GGATG 7 cut(s) 168, 195, 354, 541, 652, 748, 793
BstH2I RGCGCY 1 cut(s) 94
BstHHI GCGC 1 cut(s) 93
BstKTI GATC 7 cut(s) 31, 108, 154, 178, 235, 317, 994
BstMBI GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
BstMWI GCNNNNNNNGC 2 cut(s) 260, 383
BstNI CCWGG 1 cut(s) 657
BstNSI RCATGY 5 cut(s) 301, 724, 779, 905, 1029
BstSCI CCNGG 1 cut(s) 655
BstSFI CTRYAG 2 cut(s) 447, 798
BstV1I GCAGC 2 cut(s) 370, 557
BstV2I GAAGAC 2 cut(s) 294, 870
BstX2I RGATCY 2 cut(s) 28, 232
BstYI RGATCY 2 cut(s) 28, 232
BsuRI GGCC 3 cut(s) 1073, 1077, 1118
BtsCI GGATG 7 cut(s) 168, 195, 354, 541, 652, 748, 793
BtsIMutI CAGTG 1 cut(s) 838
Cac8I GCNNGC 4 cut(s) 337, 476, 777, 1075
CciI TCATGA 1 cut(s) 997
CfoI GCGC 1 cut(s) 93
Cfr10I RCCGGY 1 cut(s) 1073
Cfr13I GGNCC 4 cut(s) 613, 1071, 1076, 1117
Csp6I GTAC 6 cut(s) 181, 543, 581, 899, 910, 915
CviQI GTAC 6 cut(s) 181, 543, 581, 899, 910, 915
DdeI CTNAG 2 cut(s) 169, 965
DpnI GATC 7 cut(s) 30, 107, 153, 177, 234, 316, 993
DpnII GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
Eam1104I CTCTTC 1 cut(s) 1040
EarI CTCTTC 1 cut(s) 1040
Eco47I GGWCC 1 cut(s) 613
Eco47III AGCGCT 1 cut(s) 92
Eco57I CTGAAG 2 cut(s) 743, 766
EcoNI CCTNNNNNAGG 1 cut(s) 801
EcoO109I RGGNCCY 1 cut(s) 1117
EcoRI GAATTC 1 cut(s) 960
EcoRII CCWGG 1 cut(s) 655
EcoT22I ATGCAT 1 cut(s) 73
FalI AAGNNNNNCTT 2 cut(s) 1037, 1069
FauI CCCGC 1 cut(s) 1094
FauNDI CATATG 1 cut(s) 259
Fnu4HI GCNGC 2 cut(s) 384, 571
FokI GGATG 7 cut(s) 175, 182, 361, 548, 639, 755, 780
FseI GGCCGGCC 1 cut(s) 1077
Fsp4HI GCNGC 2 cut(s) 384, 571
FspBI CTAG 2 cut(s) 155, 681
GlaI GCGC 1 cut(s) 92
GluI GCNGC 2 cut(s) 384, 571
HaeII RGCGCY 1 cut(s) 94
HaeIII GGCC 3 cut(s) 1073, 1077, 1118
HapII CCGG 1 cut(s) 1074
HhaI GCGC 1 cut(s) 93
Hin6I GCGC 1 cut(s) 91
HinP1I GCGC 1 cut(s) 91
HincII GTYRAC 2 cut(s) 211, 699
HindII GTYRAC 2 cut(s) 211, 699
HinfI GANTC 4 cut(s) 185, 397, 628, 752
HpaI GTTAAC 1 cut(s) 699
HpaII CCGG 1 cut(s) 1074
Hpy166II GTNNAC 5 cut(s) 118, 211, 604, 699, 899
Hpy188I TCNGA 3 cut(s) 396, 496, 785
Hpy188III TCNNGA 6 cut(s) 401, 556, 593, 734, 941, 998
Hpy8I GTNNAC 5 cut(s) 118, 211, 604, 699, 899
HpyAV CCTTC 6 cut(s) 407, 497, 533, 790, 797, 1025
HpyCH4III ACNGT 4 cut(s) 842, 855, 914, 1066
HpyCH4V TGCA 6 cut(s) 65, 71, 431, 478, 573, 1025
HpyF10VI GCNNNNNNNGC 2 cut(s) 260, 383
HpyF3I CTNAG 2 cut(s) 169, 965
HspAI GCGC 1 cut(s) 91
KroI GCCGGC 1 cut(s) 1073
KroNI GCCGGC 1 cut(s) 1075
KspAI GTTAAC 1 cut(s) 699
Kzo9I GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
LmnI GCTCC 1 cut(s) 259
Lsp1109I GCAGC 2 cut(s) 370, 557
LweI GCATC 2 cut(s) 58, 348
MaeI CTAG 2 cut(s) 155, 681
MalI GATC 7 cut(s) 30, 107, 153, 177, 234, 316, 993
MboI GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
MboII GAAGA 5 cut(s) 299, 429, 870, 1024, 1057
MflI RGATCY 2 cut(s) 28, 232
MluCI AATT 5 cut(s) 357, 737, 951, 960, 1109
MmeI TCCRAC 1 cut(s) 247
MnlI CCTC 9 cut(s) 94, 152, 302, 474, 808, 839, 872, 1084, 1108
Mph1103I ATGCAT 1 cut(s) 73
MroNI GCCGGC 1 cut(s) 1073
MroXI GAANNNNTTC 1 cut(s) 756
MseI TTAA 4 cut(s) 138, 245, 305, 698
MslI CAYNNNNRTG 1 cut(s) 725
MspI CCGG 1 cut(s) 1074
MspR9I CCNGG 1 cut(s) 657
Mva1269I GAATGC 1 cut(s) 642
MvaI CCWGG 1 cut(s) 657
MwoI GCNNNNNNNGC 2 cut(s) 260, 383
NaeI GCCGGC 1 cut(s) 1075
NdeI CATATG 1 cut(s) 259
NdeII GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
NgoMIV GCCGGC 1 cut(s) 1073
NlaIV GGNNCC 6 cut(s) 30, 234, 485, 732, 939, 1119
NsiI ATGCAT 1 cut(s) 73
NspI RCATGY 5 cut(s) 301, 724, 779, 905, 1029
PaeI GCATGC 1 cut(s) 779
PagI TCATGA 1 cut(s) 997
PciI ACATGT 3 cut(s) 297, 720, 901
PctI GAATGC 1 cut(s) 642
PdiI GCCGGC 1 cut(s) 1075
PdmI GAANNNNTTC 1 cut(s) 756
PfeI GAWTC 4 cut(s) 185, 397, 628, 752
PflMI CCANNNNNTGG 1 cut(s) 871
PfoI TCCNGGA 1 cut(s) 655
PkrI GCNGC 2 cut(s) 385, 572
PscI ACATGT 3 cut(s) 297, 720, 901
PsiI TTATAA 1 cut(s) 390
Psp6I CCWGG 1 cut(s) 655
PspGI CCWGG 1 cut(s) 655
PspN4I GGNNCC 6 cut(s) 30, 234, 485, 732, 939, 1119
PspPI GGNCC 4 cut(s) 613, 1071, 1076, 1117
PsrI GAACNNNNNNTAC 2 cut(s) 573, 605
PsuI RGATCY 2 cut(s) 28, 232
RigI GGCCGGCC 1 cut(s) 1077
RsaI GTAC 6 cut(s) 182, 544, 582, 900, 911, 916
RsaNI GTAC 6 cut(s) 181, 543, 581, 899, 910, 915
RseI CAYNNNNRTG 1 cut(s) 725
SaqAI TTAA 4 cut(s) 138, 245, 305, 698
SatI GCNGC 2 cut(s) 384, 571
Sau3AI GATC 7 cut(s) 28, 105, 151, 175, 232, 314, 991
Sau96I GGNCC 4 cut(s) 613, 1071, 1076, 1117
ScaI AGTACT 1 cut(s) 582
ScrFI CCNGG 1 cut(s) 657
SfaNI GCATC 2 cut(s) 58, 348
SfcI CTRYAG 2 cut(s) 447, 798
SinI GGWCC 1 cut(s) 613
SmiMI CAYNNNNRTG 1 cut(s) 725
SmlI CTYRAG 1 cut(s) 1095
SmoI CTYRAG 1 cut(s) 1095
SphI GCATGC 1 cut(s) 779
Sse9I AATT 5 cut(s) 357, 737, 951, 960, 1109
SsiI CCGC 1 cut(s) 1101
SspI AATATT 1 cut(s) 205
SspMI CTAG 2 cut(s) 155, 681
StyD4I CCNGG 1 cut(s) 655
TaaI ACNGT 4 cut(s) 842, 855, 914, 1066
TasI AATT 5 cut(s) 357, 737, 951, 960, 1109
TatI WGTACW 3 cut(s) 580, 898, 914
TfiI GAWTC 4 cut(s) 185, 397, 628, 752
Tru1I TTAA 4 cut(s) 138, 245, 305, 698
Tru9I TTAA 4 cut(s) 138, 245, 305, 698
TscAI CASTG 1 cut(s) 845
TseI GCWGC 2 cut(s) 383, 570
TspDTI ATGAA 7 cut(s) 99, 552, 641, 715, 765, 1007, 1024
TspRI CASTG 1 cut(s) 845
Van91I CCANNNNNTGG 1 cut(s) 871
VpaK11BI GGWCC 1 cut(s) 613
XagI CCTNNNNNAGG 1 cut(s) 801
XapI RAATTY 3 cut(s) 951, 960, 1109
XceI RCATGY 5 cut(s) 301, 724, 779, 905, 1029
XmnI GAANNNNTTC 1 cut(s) 756
XspI CTAG 2 cut(s) 155, 681
ZrmI AGTACT 1 cut(s) 582
Zsp2I ATGCAT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.