RchiOBHm_Chr5g0020811

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000739
Physical Location & Seq
Reverse (-)
15073505 .. 15074555
1051 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30088

Sequence Viewer

Length: 186 bp
ATGGCATTCAAAGCTACTCTCTATTGTGCTTATCTAGAATTAAAATCTGACCTCTTTGCCATACACTATAAATATCCAGGTTTGTTCTATTTTCTTTATTGCGTTCCCCTATATTTGTTTACAAAAAAAGGAGTGAGGGAAGGAGAAATTTTGAGACTAAGGAGGAACCTGAGAAGTATAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.33

Weight (kDa)

9.59

Isoelectric Point (pI)

58.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 147
AgsI TTSAA 1 cut(s) 10
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Alw26I GTCTC 1 cut(s) 148
ApoI RAATTY 1 cut(s) 147
BciT130I CCWGG 1 cut(s) 78
BcoDI GTCTC 1 cut(s) 148
BfaI CTAG 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 78
BmiI GGNNCC 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 78
BseBI CCWGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 161
BsmAI GTCTC 1 cut(s) 148
BsmI GAATGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 78
BstDEI CTNAG 2 cut(s) 158, 170
BstMAI GTCTC 1 cut(s) 148
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 1 cut(s) 76
CviJI RGCY 1 cut(s) 14
CviKI_1 RGCY 1 cut(s) 14
DdeI CTNAG 2 cut(s) 158, 170
EcoRII CCWGG 1 cut(s) 76
FaiI YATR 4 cut(s) 62, 69, 112, 179
FspBI CTAG 1 cut(s) 35
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 1 cut(s) 49
Hpy188III TCNNGA 1 cut(s) 35
Hpy8I GTNNAC 1 cut(s) 120
HpyAV CCTTC 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 2 cut(s) 158, 170
LpnPI CCDG 3 cut(s) 63, 90, 182
MaeI CTAG 1 cut(s) 35
MluCI AATT 2 cut(s) 38, 147
MnlI CCTC 3 cut(s) 62, 129, 156
MseI TTAA 1 cut(s) 41
MspR9I CCNGG 1 cut(s) 78
Mva1269I GAATGC 1 cut(s) 5
MvaI CCWGG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 167
PctI GAATGC 1 cut(s) 5
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspN4I GGNNCC 1 cut(s) 167
SaqAI TTAA 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 78
SetI ASST 4 cut(s) 16, 54, 82, 171
SgeI CNNG 4 cut(s) 47, 89, 90, 181
Sse9I AATT 2 cut(s) 38, 147
SspMI CTAG 1 cut(s) 35
StyD4I CCNGG 1 cut(s) 76
TasI AATT 2 cut(s) 38, 147
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
XapI RAATTY 1 cut(s) 147
XbaI TCTAGA 1 cut(s) 34
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.