RLG00000030190

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
57288199 .. 57288764
566 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030190

Sequence Viewer

Length: 351 bp
ATGAAAAAAAATGTCTCCTTCTCTGCCATCGCGAGAGAACCTTCTTGTCTGCGTCCTCCTTCGGTTGTTGACGACGTTGCCCCTCCGATCAAGAAGGAAGAGGTCATCCTCCTCTGTGATTCAAATCTTGATGGCGATGAATTGGAGGTGAAAGTCAAGCTAAAGGACCGGGCTTTGGGGTTCCTTAAACGGGGGGTCTGTGATAGAGGCGGCACGGTCGACGCAGTGGGATGGTCTACAGCGGCGACTGGTGAACGGGAAGGGATGCTAGGGTTTCCTTGTGTTGAGCTTAAGAGGCTTAGGCTGTATTGGGCCCGGTCTCTGTTGGAGTTCGACTGCCCATTGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

12.85

Weight (kDa)

6.3

Isoelectric Point (pI)

38.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 219, 236
AccII CGCG 1 cut(s) 32
AciI CCGC 2 cut(s) 210, 242
AfiI CCNNNNNNNGG 2 cut(s) 175, 190
AflII CTTAAG 1 cut(s) 290
AgsI TTSAA 1 cut(s) 123
AluBI AGCT 2 cut(s) 160, 289
AluI AGCT 2 cut(s) 160, 289
Alw26I GTCTC 2 cut(s) 19, 324
AoxI GGCC 1 cut(s) 312
ApaI GGGCCC 1 cut(s) 316
AspS9I GGNCC 3 cut(s) 166, 312, 313
AsuC2I CCSGG 2 cut(s) 170, 316
AsuHPI GGTGA 2 cut(s) 160, 263
AvaII GGWCC 1 cut(s) 166
BaeGI GKGCMC 1 cut(s) 316
BanII GRGCYC 1 cut(s) 316
BccI CCATC 3 cut(s) 35, 125, 225
BcnI CCSGG 2 cut(s) 170, 316
BcoDI GTCTC 2 cut(s) 19, 324
BfaI CTAG 1 cut(s) 269
BfmI CTRYAG 1 cut(s) 237
BfrI CTTAAG 1 cut(s) 290
BisI GCNGC 2 cut(s) 211, 243
BlsI GCNGC 2 cut(s) 212, 244
Bme1390I CCNGG 2 cut(s) 170, 316
Bme18I GGWCC 1 cut(s) 166
BmgT120I GGNCC 3 cut(s) 166, 312, 313
BmiI GGNNCC 2 cut(s) 182, 314
BmrFI CCNGG 2 cut(s) 170, 316
BmsI GCATC 1 cut(s) 255
Bpu10I CCTNAGC 1 cut(s) 299
BpuMI CCSGG 2 cut(s) 170, 316
BsaBI GATNNNNATC 1 cut(s) 123
BsaI GGTCTC 1 cut(s) 324
Bsc4I CCNNNNNNNGG 2 cut(s) 175, 190
Bse1I ACTGG 1 cut(s) 253
Bse8I GATNNNNATC 1 cut(s) 123
BseGI GGATG 3 cut(s) 105, 236, 270
BseJI GATNNNNATC 1 cut(s) 123
BseLI CCNNNNNNNGG 2 cut(s) 175, 190
BseNI ACTGG 1 cut(s) 253
BseRI GAGGAG 1 cut(s) 101
BseSI GKGCMC 1 cut(s) 316
Bsh1236I CGCG 1 cut(s) 32
Bsh1285I CGRYCG 1 cut(s) 219
BshFI GGCC 1 cut(s) 314
BsiEI CGRYCG 1 cut(s) 219
BsiSI CCGG 2 cut(s) 169, 316
BslI CCNNNNNNNGG 2 cut(s) 175, 190
BsmAI GTCTC 2 cut(s) 19, 324
BsnI GGCC 1 cut(s) 314
Bso31I GGTCTC 1 cut(s) 324
Bsp120I GGGCCC 1 cut(s) 312
Bsp1286I GDGCHC 1 cut(s) 316
Bsp143I GATC 1 cut(s) 87
Bsp68I TCGCGA 1 cut(s) 32
BspACI CCGC 2 cut(s) 210, 242
BspANI GGCC 1 cut(s) 314
BspFNI CGCG 1 cut(s) 32
BspLI GGNNCC 2 cut(s) 182, 314
BspTI CTTAAG 1 cut(s) 290
BspTNI GGTCTC 1 cut(s) 324
BsrI ACTGG 1 cut(s) 253
BssMI GATC 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 217
Bst6I CTCTTC 1 cut(s) 93
BstAFI CTTAAG 1 cut(s) 290
BstDEI CTNAG 1 cut(s) 299
BstF5I GGATG 3 cut(s) 105, 236, 270
BstFNI CGCG 1 cut(s) 32
BstKTI GATC 1 cut(s) 90
BstMAI GTCTC 2 cut(s) 19, 324
BstMBI GATC 1 cut(s) 87
BstMCI CGRYCG 1 cut(s) 219
BstMWI GCNNNNNNNGC 1 cut(s) 295
BstSCI CCNGG 2 cut(s) 168, 314
BstSFI CTRYAG 1 cut(s) 237
BstSLI GKGCMC 1 cut(s) 316
BstUI CGCG 1 cut(s) 32
BsuRI GGCC 1 cut(s) 314
BtgZI GCGATG 2 cut(s) 13, 150
BtsCI GGATG 3 cut(s) 105, 236, 270
BtsI GCAGTG 1 cut(s) 231
BtsIMutI CAGTG 1 cut(s) 231
BtuMI TCGCGA 1 cut(s) 32
Cfr13I GGNCC 3 cut(s) 166, 312, 313
CseI GACGC 2 cut(s) 41, 230
CviJI RGCY 6 cut(s) 160, 173, 289, 298, 304, 314
CviKI_1 RGCY 6 cut(s) 160, 173, 289, 298, 304, 314
DdeI CTNAG 1 cut(s) 299
DpnI GATC 1 cut(s) 89
DpnII GATC 1 cut(s) 87
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
Eco24I GRGCYC 1 cut(s) 316
Eco31I GGTCTC 1 cut(s) 324
Eco47I GGWCC 1 cut(s) 166
EcoT38I GRGCYC 1 cut(s) 316
FblI GTMKAC 2 cut(s) 219, 236
Fnu4HI GCNGC 2 cut(s) 211, 243
FokI GGATG 3 cut(s) 92, 243, 277
FriOI GRGCYC 1 cut(s) 316
Fsp4HI GCNGC 2 cut(s) 211, 243
FspBI CTAG 1 cut(s) 269
GluI GCNGC 2 cut(s) 211, 243
HaeIII GGCC 1 cut(s) 314
HapII CCGG 2 cut(s) 169, 316
HgaI GACGC 2 cut(s) 41, 230
HincII GTYRAC 2 cut(s) 70, 220
HindII GTYRAC 2 cut(s) 70, 220
HinfI GANTC 1 cut(s) 119
HpaII CCGG 2 cut(s) 169, 316
HphI GGTGA 2 cut(s) 160, 263
Hpy166II GTNNAC 4 cut(s) 70, 220, 237, 254
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 3 cut(s) 31, 91, 128
Hpy8I GTNNAC 4 cut(s) 70, 220, 237, 254
Hpy99I CGWCG 2 cut(s) 77, 224
HpyAV CCTTC 5 cut(s) 28, 51, 69, 88, 254
HpyCH4III ACNGT 1 cut(s) 217
HpyCH4IV ACGT 1 cut(s) 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 295
HpyF3I CTNAG 1 cut(s) 299
HpySE526I ACGT 1 cut(s) 75
Kzo9I GATC 1 cut(s) 87
LpnPI CCDG 3 cut(s) 182, 234, 329
LweI GCATC 1 cut(s) 255
MaeI CTAG 1 cut(s) 269
MaeII ACGT 1 cut(s) 75
MalI GATC 1 cut(s) 89
MboI GATC 1 cut(s) 87
MboII GAAGA 1 cut(s) 110
MhlI GDGCHC 1 cut(s) 316
MluCI AATT 1 cut(s) 140
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 8 cut(s) 66, 93, 94, 119, 122, 139, 200, 288
MseI TTAA 2 cut(s) 186, 291
MspA1I CMGCKG 1 cut(s) 242
MspCI CTTAAG 1 cut(s) 290
MspI CCGG 2 cut(s) 169, 316
MspR9I CCNGG 2 cut(s) 170, 316
MvnI CGCG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 295
NciI CCSGG 2 cut(s) 170, 316
NdeII GATC 1 cut(s) 87
NlaIV GGNNCC 2 cut(s) 182, 314
NruI TCGCGA 1 cut(s) 32
PfeI GAWTC 1 cut(s) 119
PkrI GCNGC 2 cut(s) 212, 244
PspN4I GGNNCC 2 cut(s) 182, 314
PspOMI GGGCCC 1 cut(s) 312
PspPI GGNCC 3 cut(s) 166, 312, 313
RruI TCGCGA 1 cut(s) 32
SalI GTCGAC 1 cut(s) 218
SaqAI TTAA 2 cut(s) 186, 291
SatI GCNGC 2 cut(s) 211, 243
Sau3AI GATC 1 cut(s) 87
Sau96I GGNCC 3 cut(s) 166, 312, 313
ScrFI CCNGG 2 cut(s) 170, 316
SduI GDGCHC 1 cut(s) 316
SetI ASST 6 cut(s) 43, 78, 105, 150, 162, 291
SfaNI GCATC 1 cut(s) 255
SfcI CTRYAG 1 cut(s) 237
SinI GGWCC 1 cut(s) 166
SmlI CTYRAG 1 cut(s) 290
SmoI CTYRAG 1 cut(s) 290
Sse9I AATT 1 cut(s) 140
SsiI CCGC 2 cut(s) 210, 242
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 2 cut(s) 168, 314
TaaI ACNGT 1 cut(s) 217
TaiI ACGT 1 cut(s) 78
TaqI TCGA 2 cut(s) 219, 333
TasI AATT 1 cut(s) 140
TauI GCSGC 2 cut(s) 213, 245
TfiI GAWTC 1 cut(s) 119
Tru1I TTAA 2 cut(s) 186, 291
Tru9I TTAA 2 cut(s) 186, 291
TscAI CASTG 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 17, 153
TspRI CASTG 1 cut(s) 231
Vha464I CTTAAG 1 cut(s) 290
VpaK11BI GGWCC 1 cut(s) 166
XmiI GTMKAC 2 cut(s) 219, 236
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.