Rroxscaffold_2G00107580

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000739
Physical Location & Seq
Reverse (-)
31545839 .. 31549851
4013 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00107580.1

Sequence Viewer

Length: 462 bp
ATGAGGTATCTGAATTTGAAAAAAGAGAATGTCCGCTTGCGGCTATCTAACCCGAGTGCCGGTGGTAAACCTACGATCGGAAAGGTGGGATTTTCTCTTCTCTCGATTGCAATTCCGAGGACGTCGGTGGGCTTCGGCTTCATCAAGTCGCCGAGTTTGCTGCAACGGTCATCTTCGGTGATCGGAGTCACCCTTCCTTTATGGCCGGGGGATCTATCGGTGGGGGTGCTCGATGGTGGCTGCAAAGGTGATGCGGCAAGGTTTCAAGTCCGGCGCAATGGGGCTTTTCCGGGTGGCTCGTTGATGGTGGAAGGAATGAGAGCTAGCCTTTTGTCTGTTTCATATATGTTTCTACCCACGTCGGTCGAACCGGGTGGATTGGATCTTGTTTTGGTAGTGTTCGTCGATGCTATTCGGGTTGCAGAGGATGGCCGCAATGTGGTGGCTAGTCCGGACGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

153

Amino Acids

16.13

Weight (kDa)

9.79

Isoelectric Point (pI)

34.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 125
AccIII TCCGGA 1 cut(s) 451
AciI CCGC 4 cut(s) 34, 40, 254, 433
AclWI GGATC 2 cut(s) 219, 390
AcoI YGGCCR 2 cut(s) 203, 430
AcsI RAATTY 1 cut(s) 13
AcyI GRCGYC 1 cut(s) 122
AfiI CCNNNNNNNGG 3 cut(s) 59, 77, 439
AgsI TTSAA 2 cut(s) 19, 266
AjiI CACGTC 1 cut(s) 360
AluBI AGCT 1 cut(s) 323
AluI AGCT 1 cut(s) 323
Alw21I GWGCWC 1 cut(s) 231
AlwI GGATC 2 cut(s) 219, 390
Ama87I CYCGRG 1 cut(s) 52
Aor13HI TCCGGA 1 cut(s) 451
AoxI GGCC 2 cut(s) 203, 430
ApeKI GCWGC 2 cut(s) 160, 240
ApoI RAATTY 1 cut(s) 13
AspLEI GCGC 1 cut(s) 276
AsuC2I CCSGG 3 cut(s) 207, 291, 372
AsuHPI GGTGA 3 cut(s) 181, 190, 260
AsuNHI GCTAGC 1 cut(s) 323
AvaI CYCGRG 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 231
BbvI GCAGC 2 cut(s) 147, 227
BccI CCATC 3 cut(s) 227, 298, 422
BcgI CGANNNNNNTGC 2 cut(s) 142, 176
BcnI CCSGG 3 cut(s) 207, 291, 372
BfaI CTAG 2 cut(s) 324, 447
BisI GCNGC 5 cut(s) 41, 161, 241, 255, 433
BlsI GCNGC 5 cut(s) 42, 162, 242, 256, 434
Bme1390I CCNGG 3 cut(s) 207, 291, 372
BmeT110I CYCGRG 1 cut(s) 52
BmgBI CACGTC 1 cut(s) 360
BmrFI CCNGG 3 cut(s) 207, 291, 372
BmsI GCATC 2 cut(s) 241, 397
BmtI GCTAGC 1 cut(s) 327
BpuMI CCSGG 3 cut(s) 207, 291, 372
BsaHI GRCGYC 1 cut(s) 122
BsaJI CCNNGG 2 cut(s) 116, 206
BsaWI WCCGGW 1 cut(s) 451
Bsc4I CCNNNNNNNGG 3 cut(s) 59, 77, 439
Bse118I RCCGGY 1 cut(s) 59
Bse3DI GCAATG 2 cut(s) 283, 442
BseAI TCCGGA 1 cut(s) 451
BseDI CCNNGG 2 cut(s) 116, 206
BseGI GGATG 1 cut(s) 433
BseLI CCNNNNNNNGG 3 cut(s) 59, 77, 439
BseMI GCAATG 2 cut(s) 283, 442
BseXI GCAGC 2 cut(s) 147, 227
Bsh1285I CGRYCG 2 cut(s) 78, 366
BshFI GGCC 2 cut(s) 205, 432
BsiEI CGRYCG 2 cut(s) 78, 366
BsiHKAI GWGCWC 1 cut(s) 231
BsiHKCI CYCGRG 1 cut(s) 52
BsiSI CCGG 6 cut(s) 60, 206, 271, 290, 371, 452
BslI CCNNNNNNNGG 3 cut(s) 59, 77, 439
BsnI GGCC 2 cut(s) 205, 432
BsoBI CYCGRG 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 231
Bsp13I TCCGGA 1 cut(s) 451
Bsp143I GATC 4 cut(s) 75, 180, 211, 382
BspACI CCGC 4 cut(s) 34, 40, 254, 433
BspANI GGCC 2 cut(s) 205, 432
BspEI TCCGGA 1 cut(s) 451
BspOI GCTAGC 1 cut(s) 327
BspPI GGATC 2 cut(s) 219, 390
BsrDI GCAATG 2 cut(s) 283, 442
BsrFI RCCGGY 1 cut(s) 59
BssAI RCCGGY 1 cut(s) 59
BssECI CCNNGG 2 cut(s) 116, 206
BssMI GATC 4 cut(s) 75, 180, 211, 382
BssNI GRCGYC 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 168
Bst6I CTCTTC 1 cut(s) 102
BstACI GRCGYC 1 cut(s) 122
BstC8I GCNNGC 2 cut(s) 38, 325
BstF5I GGATG 1 cut(s) 433
BstHHI GCGC 1 cut(s) 276
BstKTI GATC 4 cut(s) 78, 183, 214, 385
BstMBI GATC 4 cut(s) 75, 180, 211, 382
BstMCI CGRYCG 2 cut(s) 78, 366
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstSCI CCNGG 3 cut(s) 205, 289, 370
BstV1I GCAGC 2 cut(s) 147, 227
BstX2I RGATCY 2 cut(s) 211, 382
BstYI RGATCY 2 cut(s) 211, 382
BsuRI GGCC 2 cut(s) 205, 432
BtrI CACGTC 1 cut(s) 360
BtsCI GGATG 1 cut(s) 433
Cac8I GCNNGC 2 cut(s) 38, 325
CfoI GCGC 1 cut(s) 276
Cfr10I RCCGGY 1 cut(s) 59
DpnI GATC 4 cut(s) 77, 182, 213, 384
DpnII GATC 4 cut(s) 75, 180, 211, 382
EaeI YGGCCR 2 cut(s) 203, 430
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
Eco88I CYCGRG 1 cut(s) 52
FaiI YATR 4 cut(s) 202, 343, 345, 347
Fnu4HI GCNGC 5 cut(s) 41, 161, 241, 255, 433
FokI GGATG 1 cut(s) 440
Fsp4HI GCNGC 5 cut(s) 41, 161, 241, 255, 433
FspBI CTAG 2 cut(s) 324, 447
GlaI GCGC 1 cut(s) 275
GluI GCNGC 5 cut(s) 41, 161, 241, 255, 433
HaeIII GGCC 2 cut(s) 205, 432
HapII CCGG 6 cut(s) 60, 206, 271, 290, 371, 452
HhaI GCGC 1 cut(s) 276
Hin1I GRCGYC 1 cut(s) 122
Hin6I GCGC 1 cut(s) 274
HinP1I GCGC 1 cut(s) 274
HinfI GANTC 1 cut(s) 186
HpaII CCGG 6 cut(s) 60, 206, 271, 290, 371, 452
HphI GGTGA 3 cut(s) 181, 190, 260
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 4 cut(s) 12, 80, 117, 185
Hpy188III TCNNGA 2 cut(s) 103, 452
Hpy8I GTNNAC 1 cut(s) 68
Hpy99I CGWCG 3 cut(s) 127, 364, 407
HpyAV CCTTC 2 cut(s) 203, 305
HpyCH4III ACNGT 1 cut(s) 168
HpyCH4IV ACGT 2 cut(s) 122, 359
HpyCH4V TGCA 4 cut(s) 110, 163, 243, 422
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
HpySE526I ACGT 2 cut(s) 122, 359
Hsp92I GRCGYC 1 cut(s) 122
HspAI GCGC 1 cut(s) 274
Kpn2I TCCGGA 1 cut(s) 451
Kzo9I GATC 4 cut(s) 75, 180, 211, 382
LpnPI CCDG 5 cut(s) 73, 219, 284, 303, 384
Lsp1109I GCAGC 2 cut(s) 147, 227
LweI GCATC 2 cut(s) 241, 397
MaeI CTAG 2 cut(s) 324, 447
MaeII ACGT 2 cut(s) 122, 359
MaeIII GTNAC 1 cut(s) 187
MalI GATC 4 cut(s) 77, 182, 213, 384
MboI GATC 4 cut(s) 75, 180, 211, 382
MboII GAAGA 2 cut(s) 89, 165
MflI RGATCY 2 cut(s) 211, 382
MhlI GDGCHC 1 cut(s) 231
MluCI AATT 2 cut(s) 13, 111
MlyI GAGTC 1 cut(s) 195
MnlI CCTC 2 cut(s) 111, 418
MroI TCCGGA 1 cut(s) 451
MspI CCGG 6 cut(s) 60, 206, 271, 290, 371, 452
MspR9I CCNGG 3 cut(s) 207, 291, 372
MwoI GCNNNNNNNGC 1 cut(s) 157
NciI CCSGG 3 cut(s) 207, 291, 372
NdeII GATC 4 cut(s) 75, 180, 211, 382
NheI GCTAGC 1 cut(s) 323
NmeAIII GCCGAG 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 187
PkrI GCNGC 5 cut(s) 42, 162, 242, 256, 434
Ple19I CGATCG 1 cut(s) 78
PleI GAGTC 1 cut(s) 194
PpsI GAGTC 1 cut(s) 194
PsuI RGATCY 2 cut(s) 211, 382
PvuI CGATCG 1 cut(s) 78
SatI GCNGC 5 cut(s) 41, 161, 241, 255, 433
Sau3AI GATC 4 cut(s) 75, 180, 211, 382
SchI GAGTC 1 cut(s) 195
ScrFI CCNGG 3 cut(s) 207, 291, 372
SduI GDGCHC 1 cut(s) 231
SetI ASST 8 cut(s) 8, 73, 87, 125, 250, 263, 325, 362
SfaNI GCATC 2 cut(s) 241, 397
Sse9I AATT 2 cut(s) 13, 111
SsiI CCGC 4 cut(s) 34, 40, 254, 433
SspMI CTAG 2 cut(s) 324, 447
StyD4I CCNGG 3 cut(s) 205, 289, 370
TaaI ACNGT 1 cut(s) 168
TaiI ACGT 2 cut(s) 125, 362
TaqI TCGA 4 cut(s) 104, 231, 366, 405
TaqII GACCGA 1 cut(s) 352
TasI AATT 2 cut(s) 13, 111
TauI GCSGC 3 cut(s) 43, 257, 435
TseFI GTSAC 1 cut(s) 187
TseI GCWGC 2 cut(s) 160, 240
Tsp45I GTSAC 1 cut(s) 187
TspDTI ATGAA 2 cut(s) 130, 330
XapI RAATTY 1 cut(s) 13
XspI CTAG 2 cut(s) 324, 447
ZraI GACGTC 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.