Rmu_co8314937.1_g000001

Domain of unknown function (DUF3403)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8314937.1
Physical Location & Seq
Reverse (-)
2 .. 887
886 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8314937.1_g000001.1.cds

Sequence Viewer

Length: 679 bp
atgcctagcacgagggttatcatcagaaaagaattgtgtcctcttatctgcttcatatttttatttagcttctttttatcttcatcttttgcaacagacacactaacacccggagacacacttacagtcaatcaaaccctggtttcagctggtggagttttcgagcttggcttcttcaaaagtgacttttcaggtagttactatctaggaatttggttcagagccgatgcaaacaaggttgtttgggttggtaaccgcagagttcccatattggacgcttcaggaagtcttcaaatactatctgggaatctggttcttatagaccgccatcaaaaccatttgctagtcagtacaggaaatgttgccatggccataaacgcaaccgcaacacttcttgactctggaaattttatccttaaagaagcaaatacaggtactatgctatggcaaagttttgatattcctactgatacttatcttcctgggatgaaacttggttggtctcagcttaacagtaaccagccaatctttcgcgcttttgtttcttgggtcaacccccaaaatcctgctcttggcaactttactttaaccatggataggatcaactttacaaagattcaggtttggcgaggagataaagttcgaatggatattgggttttgggatggacataacctgc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

226

Amino Acids

25.22

Weight (kDa)

7.8

Isoelectric Point (pI)

21.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000509)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g29542 FvH4_2g29543 FvH4_2g29543 FvH4_2g29543 FvH4_2g29543 FvH4_2g29544 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29560
malus_domestica MD15G1121300.v1.1
prunus_persica Prupe.1G473900_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474100_v2.0.a1 Prupe.1G474300_v2.0.a1 Prupe.1G474500_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0298411 RchiOBHm_Chr6g0298421 RchiOBHm_Chr6g0298431 RchiOBHm_Chr6g0298441 RchiOBHm_Chr6g0298451 RchiOBHm_Chr6g0298461 RchiOBHm_Chr6g0298471 RchiOBHm_Chr6g0298481 RchiOBHm_Chr6g0298491 RchiOBHm_Chr6g0298501 RchiOBHm_Chr6g0298521
rosa_laevigata RLG00000011506 RLG00000011508 RLG00000011509 RLG00000011511 RLG00000011513 RLG00000011514 RLG00000011515
rosa_multiflora Rmu_co8314937.1_g000001 Rmu_co8319199.1_g000001 Rmu_sc0004500.1_g000002 Rmu_sc0006543.1_g000001 Rmu_ssc0000289.1_g000039 Rmu_ssc0000289.1_g000040 Rmu_ssc0000289.1_g000047 Rmu_ssc0000289.1_g000048 Rmu_ssc0000289.1_g000049 Rmu_ssc0000289.1_g000051
rosa_roxburghii Rroxscaffold_7G00169570 Rroxscaffold_7G00169580 Rroxscaffold_7G00169600 Rroxscaffold_7G00169610 Rroxscaffold_7G00169620 Rroxscaffold_7G00169630 Rroxscaffold_7G00169650 Rroxscaffold_7G00169660 Rroxscaffold_7G00169670
rosa_rugosa Rorug06G0280700 Rorug06G0280800 Rorug06G0280900
rosa_samantha Rh6AG391700 Rh6AG391800 Rh6AG392000 Rh6AG392100 Rh6AG392200 Rh6BG399300 Rh6BG399400 Rh6BG399500 Rh6BG399700 Rh6BG400000 Rh6CG405400 Rh6CG405500 Rh6CG405600 Rh6CG405700 Rh6CG405800 Rh6DG391800 Rh6DG391900 Rh6DG392000 Rh6DG392100 Rh6DG392300
rosa_wichuraiana Rw6G034230 Rw6G034240 Rw6G034250 Rw6G034260 Rw6G034270 Rw6G034280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 534
AciI CCGC 3 cut(s) 256, 325, 384
AclWI GGATC 1 cut(s) 608
AcoI YGGCCR 1 cut(s) 369
AcsI RAATTY 2 cut(s) 210, 406
AcuI CTGAAG 1 cut(s) 264
AfaI GTAC 2 cut(s) 352, 436
AfiI CCNNNNNNNGG 2 cut(s) 572, 597
AgsI TTSAA 2 cut(s) 178, 293
AjnI CCWGG 2 cut(s) 138, 481
AloI GAACNNNNNNTCC 2 cut(s) 624, 656
AluBI AGCT 4 cut(s) 69, 149, 166, 508
AluI AGCT 4 cut(s) 69, 149, 166, 508
Alw26I GTCTC 2 cut(s) 108, 507
AlwI GGATC 1 cut(s) 608
AoxI GGCC 1 cut(s) 369
ApoI RAATTY 2 cut(s) 210, 406
AspLEI GCGC 1 cut(s) 536
AsuC2I CCSGG 1 cut(s) 111
AsuII TTCGAA 1 cut(s) 643
BalI TGGCCA 1 cut(s) 371
BauI CACGAG 1 cut(s) 10
BbsI GAAGAC 1 cut(s) 281
BccI CCATC 2 cut(s) 336, 659
BciT130I CCWGG 2 cut(s) 140, 483
BcnI CCSGG 1 cut(s) 111
BcoDI GTCTC 2 cut(s) 108, 507
BfaI CTAG 3 cut(s) 6, 206, 344
Bme1390I CCNGG 3 cut(s) 111, 140, 483
BmrFI CCNGG 3 cut(s) 111, 140, 483
BmsI GCATC 1 cut(s) 217
BpiI GAAGAC 1 cut(s) 281
Bpu14I TTCGAA 1 cut(s) 643
BpuMI CCSGG 1 cut(s) 111
BsaBI GATNNNNATC 1 cut(s) 474
BsaI GGTCTC 1 cut(s) 507
BsaJI CCNNGG 4 cut(s) 138, 366, 482, 591
BsaXI ACNNNNNCTCC 2 cut(s) 624, 654
Bsc4I CCNNNNNNNGG 2 cut(s) 572, 597
Bse8I GATNNNNATC 1 cut(s) 474
BseBI CCWGG 2 cut(s) 140, 483
BseDI CCNNGG 4 cut(s) 138, 366, 482, 591
BseGI GGATG 2 cut(s) 492, 670
BseJI GATNNNNATC 1 cut(s) 474
BseLI CCNNNNNNNGG 2 cut(s) 572, 597
BseMII CTCAG 1 cut(s) 518
BseRI GAGGAG 1 cut(s) 645
Bsh1236I CGCG 1 cut(s) 534
BshFI GGCC 1 cut(s) 371
BsiSI CCGG 1 cut(s) 111
BslI CCNNNNNNNGG 2 cut(s) 572, 597
BsmAI GTCTC 2 cut(s) 108, 507
BsnI GGCC 1 cut(s) 371
Bso31I GGTCTC 1 cut(s) 507
Bsp119I TTCGAA 1 cut(s) 643
Bsp143I GATC 1 cut(s) 600
Bsp19I CCATGG 2 cut(s) 366, 591
BspACI CCGC 3 cut(s) 256, 325, 384
BspANI GGCC 1 cut(s) 371
BspCNI CTCAG 1 cut(s) 517
BspFNI CGCG 1 cut(s) 534
BspPI GGATC 1 cut(s) 608
BspT104I TTCGAA 1 cut(s) 643
BspTNI GGTCTC 1 cut(s) 507
BssECI CCNNGG 4 cut(s) 138, 366, 482, 591
BssMI GATC 1 cut(s) 600
BssSI CACGAG 1 cut(s) 10
BssT1I CCWWGG 2 cut(s) 366, 591
Bst2BI CACGAG 1 cut(s) 10
Bst2UI CCWGG 2 cut(s) 140, 483
Bst4CI ACNGT 2 cut(s) 127, 515
BstBI TTCGAA 1 cut(s) 643
BstDEI CTNAG 1 cut(s) 504
BstDSI CCRYGG 2 cut(s) 366, 591
BstEII GGTNACC 1 cut(s) 251
BstF5I GGATG 2 cut(s) 492, 670
BstFNI CGCG 1 cut(s) 534
BstHHI GCGC 1 cut(s) 536
BstKTI GATC 1 cut(s) 603
BstMAI GTCTC 2 cut(s) 108, 507
BstMBI GATC 1 cut(s) 600
BstMWI GCNNNNNNNGC 1 cut(s) 377
BstNI CCWGG 2 cut(s) 140, 483
BstPI GGTNACC 1 cut(s) 251
BstSCI CCNGG 3 cut(s) 109, 138, 481
BstUI CGCG 1 cut(s) 534
BstV2I GAAGAC 1 cut(s) 281
BsuRI GGCC 1 cut(s) 371
BtgI CCRYGG 2 cut(s) 366, 591
BtsCI GGATG 2 cut(s) 492, 670
CfoI GCGC 1 cut(s) 536
CseI GACGC 1 cut(s) 284
Csp6I GTAC 2 cut(s) 351, 435
CviAII CATG 2 cut(s) 367, 592
CviJI RGCY 8 cut(s) 69, 149, 166, 171, 224, 371, 508, 523
CviKI_1 RGCY 8 cut(s) 69, 149, 166, 171, 224, 371, 508, 523
CviQI GTAC 2 cut(s) 351, 435
DdeI CTNAG 1 cut(s) 504
DpnI GATC 1 cut(s) 602
DpnII GATC 1 cut(s) 600
EaeI YGGCCR 1 cut(s) 369
Eco130I CCWWGG 2 cut(s) 366, 591
Eco31I GGTCTC 1 cut(s) 507
Eco57I CTGAAG 1 cut(s) 264
Eco91I GGTNACC 1 cut(s) 251
EcoO65I GGTNACC 1 cut(s) 251
EcoRII CCWGG 2 cut(s) 138, 481
EcoT14I CCWWGG 2 cut(s) 366, 591
ErhI CCWWGG 2 cut(s) 366, 591
FaeI CATG 2 cut(s) 370, 595
FaiI YATR 9 cut(s) 56, 269, 320, 368, 374, 440, 445, 593, 672
FatI CATG 2 cut(s) 366, 591
FokI GGATG 1 cut(s) 499
FspBI CTAG 3 cut(s) 6, 206, 344
GlaI GCGC 1 cut(s) 535
HaeIII GGCC 1 cut(s) 371
HapII CCGG 1 cut(s) 111
HgaI GACGC 1 cut(s) 284
HhaI GCGC 1 cut(s) 536
Hin1II CATG 2 cut(s) 370, 595
Hin6I GCGC 1 cut(s) 534
HinP1I GCGC 1 cut(s) 534
HincII GTYRAC 1 cut(s) 553
HindII GTYRAC 1 cut(s) 553
HinfI GANTC 3 cut(s) 307, 398, 616
HpaII CCGG 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 553
Hpy188I TCNGA 2 cut(s) 26, 221
Hpy188III TCNNGA 3 cut(s) 282, 395, 402
Hpy8I GTNNAC 1 cut(s) 553
HpyCH4III ACNGT 2 cut(s) 127, 515
HpyCH4V TGCA 2 cut(s) 92, 230
HpyF10VI GCNNNNNNNGC 1 cut(s) 377
HpyF3I CTNAG 1 cut(s) 504
Hsp92II CATG 2 cut(s) 370, 595
HspAI GCGC 1 cut(s) 534
Kzo9I GATC 1 cut(s) 600
LweI GCATC 1 cut(s) 217
MaeI CTAG 3 cut(s) 6, 206, 344
MaeIII GTNAC 4 cut(s) 182, 197, 251, 515
MalI GATC 1 cut(s) 602
MboI GATC 1 cut(s) 600
MboII GAAGA 4 cut(s) 72, 166, 281, 470
MlsI TGGCCA 1 cut(s) 371
MluCI AATT 3 cut(s) 32, 210, 406
MluNI TGGCCA 1 cut(s) 371
MlyI GAGTC 1 cut(s) 392
MnlI CCTC 3 cut(s) 6, 51, 623
Mox20I TGGCCA 1 cut(s) 371
MscI TGGCCA 1 cut(s) 371
MseI TTAA 3 cut(s) 417, 510, 587
Msp20I TGGCCA 1 cut(s) 371
MspA1I CMGCKG 1 cut(s) 149
MspI CCGG 1 cut(s) 111
MspR9I CCNGG 3 cut(s) 111, 140, 483
MvaI CCWGG 2 cut(s) 140, 483
MvnI CGCG 1 cut(s) 534
MwoI GCNNNNNNNGC 1 cut(s) 377
NciI CCSGG 1 cut(s) 111
NcoI CCATGG 2 cut(s) 366, 591
NdeII GATC 1 cut(s) 600
NlaIII CATG 2 cut(s) 370, 595
NmuCI GTSAC 1 cut(s) 182
NspV TTCGAA 1 cut(s) 643
PfeI GAWTC 2 cut(s) 307, 616
PleI GAGTC 1 cut(s) 392
PpsI GAGTC 1 cut(s) 392
Psp6I CCWGG 2 cut(s) 138, 481
PspEI GGTNACC 1 cut(s) 251
PspGI CCWGG 2 cut(s) 138, 481
PvuII CAGCTG 1 cut(s) 149
RsaI GTAC 2 cut(s) 352, 436
RsaNI GTAC 2 cut(s) 351, 435
SaqAI TTAA 3 cut(s) 417, 510, 587
Sau3AI GATC 1 cut(s) 600
SchI GAGTC 1 cut(s) 392
ScrFI CCNGG 3 cut(s) 111, 140, 483
SetI ASST 9 cut(s) 71, 151, 168, 196, 240, 436, 510, 624, 678
SfaNI GCATC 1 cut(s) 217
SfuI TTCGAA 1 cut(s) 643
Sse9I AATT 3 cut(s) 32, 210, 406
SsiI CCGC 3 cut(s) 256, 325, 384
SspMI CTAG 3 cut(s) 6, 206, 344
StyD4I CCNGG 3 cut(s) 109, 138, 481
StyI CCWWGG 2 cut(s) 366, 591
TaaI ACNGT 2 cut(s) 127, 515
TaqI TCGA 2 cut(s) 162, 643
TasI AATT 3 cut(s) 32, 210, 406
TatI WGTACW 1 cut(s) 350
TfiI GAWTC 2 cut(s) 307, 616
Tru1I TTAA 3 cut(s) 417, 510, 587
Tru9I TTAA 3 cut(s) 417, 510, 587
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 3 cut(s) 43, 72, 503
XapI RAATTY 2 cut(s) 210, 406
XspI CTAG 3 cut(s) 6, 206, 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.