Rmu_ssc0000289.1_g000039

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000289.1
Physical Location & Seq
Reverse (-)
235347 .. 236516
1170 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000289.1_g000039.1.cds

Sequence Viewer

Length: 1170 bp
atggttcttcttgttattgtcttgatatcatttcttagcttcttttcattttcatctcttgcaacagacacacttacaccttcagatgcattaagagacagtcaaaccctggtttcagctggtggagttttcgtgcttggctttttcaatgaaagctcttcaggttattactatctgggaatttggttcaaagctgatgcaaacaaggttgtctgggttgaccgcgaaaatcccataatggattcatctggcctgcttcaaatccggtctgggaatttggttctcacagaccgtcgacaagtgctactgatagtcaactcaggaaatcttgccaccactacaactaatacaagtgcaacacttcttgatactggaaacttggtcctaaaggaagcagttacaggtactactatatggcagagttttgatataccaactgatacttatcttcctgggatgaagattgggttatttaacctaaacacaacccagcagacctttcacattcttgtttcttgggcaagccctcaaaatccaaatcgtggcttatttaccttaagcattgatgccaacgatcacacaaggatttcggtttggcgaggagatggagctaagatgaatatcggtttctgggaaggaaatggcttaaggtttatttttgagaactcaactgagaatttgtacaattttagcttccagtccaatcaatctgaagccttctacacttttagcacaccgaagaactacgacctcatgtggtttgtgatggcttccacaggaacactggaccagtataatatgttggatgggaagatttctaatgtgagtcattctttgtgtgaagattcaaatggtggaaatactgggaggtgcttgacttcactaccatctatgtgtgatgatggtaaattttctgagatgaatggtttactaccatctaacactagtactgatttgatcattgtatggactgctgattgtgaaacgctgtgcaaaaacaattgttcttgtactgcatatacttcacttcacaatggacaaccaggatgccaactttattatgggagcagacaaaatctatcaaagatcatagagaagggcgcaggggttatttacatccgcagtggtgcttcaactggtaagtctaaaattctgaactcatgtagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

389

Amino Acids

42.7

Weight (kDa)

5.13

Isoelectric Point (pI)

30.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000509)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g29542 FvH4_2g29543 FvH4_2g29543 FvH4_2g29543 FvH4_2g29543 FvH4_2g29544 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29545 FvH4_2g29560
malus_domestica MD15G1121300.v1.1
prunus_persica Prupe.1G473900_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474000_v2.0.a1 Prupe.1G474100_v2.0.a1 Prupe.1G474300_v2.0.a1 Prupe.1G474500_v2.0.a1
rosa_chinensis RchiOBHm_Chr6g0298411 RchiOBHm_Chr6g0298421 RchiOBHm_Chr6g0298431 RchiOBHm_Chr6g0298441 RchiOBHm_Chr6g0298451 RchiOBHm_Chr6g0298461 RchiOBHm_Chr6g0298471 RchiOBHm_Chr6g0298481 RchiOBHm_Chr6g0298491 RchiOBHm_Chr6g0298501 RchiOBHm_Chr6g0298521
rosa_laevigata RLG00000011506 RLG00000011508 RLG00000011509 RLG00000011511 RLG00000011513 RLG00000011514 RLG00000011515
rosa_multiflora Rmu_co8314937.1_g000001 Rmu_co8319199.1_g000001 Rmu_sc0004500.1_g000002 Rmu_sc0006543.1_g000001 Rmu_ssc0000289.1_g000039 Rmu_ssc0000289.1_g000040 Rmu_ssc0000289.1_g000047 Rmu_ssc0000289.1_g000048 Rmu_ssc0000289.1_g000049 Rmu_ssc0000289.1_g000051
rosa_roxburghii Rroxscaffold_7G00169570 Rroxscaffold_7G00169580 Rroxscaffold_7G00169600 Rroxscaffold_7G00169610 Rroxscaffold_7G00169620 Rroxscaffold_7G00169630 Rroxscaffold_7G00169650 Rroxscaffold_7G00169660 Rroxscaffold_7G00169670
rosa_rugosa Rorug06G0280700 Rorug06G0280800 Rorug06G0280900
rosa_samantha Rh6AG391700 Rh6AG391800 Rh6AG392000 Rh6AG392100 Rh6AG392200 Rh6BG399300 Rh6BG399400 Rh6BG399500 Rh6BG399700 Rh6BG400000 Rh6CG405400 Rh6CG405500 Rh6CG405600 Rh6CG405700 Rh6CG405800 Rh6DG391800 Rh6DG391900 Rh6DG392000 Rh6DG392100 Rh6DG392300
rosa_wichuraiana Rw6G034230 Rw6G034240 Rw6G034250 Rw6G034260 Rw6G034270 Rw6G034280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 542
AccI GTMKAC 1 cut(s) 295
AccII CGCG 1 cut(s) 225
AciI CCGC 2 cut(s) 223, 1120
AcsI RAATTY 5 cut(s) 180, 274, 676, 908, 1149
AcuI CTGAAG 3 cut(s) 66, 144, 732
AfaI GTAC 4 cut(s) 406, 683, 949, 1012
AfiI CCNNNNNNNGG 1 cut(s) 542
AflII CTTAAG 2 cut(s) 556, 646
AgsI TTSAA 5 cut(s) 148, 190, 260, 849, 1134
AhlI ACTAGT 1 cut(s) 944
AjnI CCWGG 3 cut(s) 108, 451, 1042
AluBI AGCT 6 cut(s) 39, 119, 156, 194, 611, 693
AluI AGCT 6 cut(s) 39, 119, 156, 194, 611, 693
Alw26I GTCTC 1 cut(s) 90
AoxI GGCC 1 cut(s) 250
ApoI RAATTY 5 cut(s) 180, 274, 676, 908, 1149
AspLEI GCGC 1 cut(s) 1103
AspS9I GGNCC 2 cut(s) 382, 787
AvaII GGWCC 2 cut(s) 382, 787
BccI CCATC 6 cut(s) 599, 760, 800, 895, 896, 943
BciT130I CCWGG 3 cut(s) 110, 453, 1044
BclI TGATCA 1 cut(s) 957
BcoDI GTCTC 1 cut(s) 90
BcuI ACTAGT 1 cut(s) 944
BfaI CTAG 1 cut(s) 945
BfrI CTTAAG 2 cut(s) 556, 646
BmcAI AGTACT 1 cut(s) 949
Bme1390I CCNGG 3 cut(s) 110, 453, 1044
Bme18I GGWCC 2 cut(s) 382, 787
BmgT120I GGNCC 2 cut(s) 382, 787
BmrFI CCNGG 3 cut(s) 110, 453, 1044
BmrI ACTGGG 1 cut(s) 873
BmsI GCATC 4 cut(s) 76, 187, 556, 1037
BmuI ACTGGG 1 cut(s) 873
BsaBI GATNNNNATC 2 cut(s) 444, 620
BsaJI CCNNGG 2 cut(s) 108, 452
BsaWI WCCGGW 1 cut(s) 264
BsaXI ACNNNNNCTCC 2 cut(s) 117, 147
Bsc4I CCNNNNNNNGG 1 cut(s) 542
Bse1I ACTGG 6 cut(s) 376, 697, 789, 790, 868, 1141
Bse8I GATNNNNATC 2 cut(s) 444, 620
BseBI CCWGG 3 cut(s) 110, 453, 1044
BseDI CCNNGG 2 cut(s) 108, 452
BseGI GGATG 4 cut(s) 462, 811, 1052, 1116
BseJI GATNNNNATC 2 cut(s) 444, 620
BseLI CCNNNNNNNGG 1 cut(s) 542
BseMII CTCAG 3 cut(s) 333, 663, 906
BseNI ACTGG 6 cut(s) 376, 697, 789, 790, 868, 1141
BseRI GAGGAG 1 cut(s) 615
BseYI CCCAGC 1 cut(s) 489
Bsh1236I CGCG 1 cut(s) 225
BshFI GGCC 1 cut(s) 252
BsiSI CCGG 1 cut(s) 265
BslI CCNNNNNNNGG 1 cut(s) 542
BsmAI GTCTC 1 cut(s) 90
BsnI GGCC 1 cut(s) 252
Bsp1407I TGTACA 1 cut(s) 681
Bsp143I GATC 3 cut(s) 574, 957, 1086
BspACI CCGC 2 cut(s) 223, 1120
BspANI GGCC 1 cut(s) 252
BspCNI CTCAG 3 cut(s) 332, 664, 907
BspFNI CGCG 1 cut(s) 225
BspQI GCTCTTC 1 cut(s) 163
BspTI CTTAAG 2 cut(s) 556, 646
BsrGI TGTACA 1 cut(s) 681
BsrI ACTGG 6 cut(s) 376, 697, 789, 790, 868, 1141
BssECI CCNNGG 2 cut(s) 108, 452
BssMI GATC 3 cut(s) 574, 957, 1086
Bst2UI CCWGG 3 cut(s) 110, 453, 1044
Bst4CI ACNGT 2 cut(s) 101, 293
Bst6I CTCTTC 1 cut(s) 163
BstAFI CTTAAG 2 cut(s) 556, 646
BstAUI TGTACA 1 cut(s) 681
BstC8I GCNNGC 2 cut(s) 254, 523
BstDEI CTNAG 5 cut(s) 35, 319, 612, 672, 915
BstF5I GGATG 4 cut(s) 462, 811, 1052, 1116
BstFNI CGCG 1 cut(s) 225
BstHHI GCGC 1 cut(s) 1103
BstKTI GATC 3 cut(s) 577, 960, 1089
BstMAI GTCTC 1 cut(s) 90
BstMBI GATC 3 cut(s) 574, 957, 1086
BstNI CCWGG 3 cut(s) 110, 453, 1044
BstSCI CCNGG 3 cut(s) 108, 451, 1042
BstUI CGCG 1 cut(s) 225
BsuRI GGCC 1 cut(s) 252
BtsCI GGATG 4 cut(s) 462, 811, 1052, 1116
BtsI GCAGTG 1 cut(s) 1129
BtsIMutI CAGTG 2 cut(s) 782, 1129
Cac8I GCNNGC 2 cut(s) 254, 523
CfoI GCGC 1 cut(s) 1103
Cfr13I GGNCC 2 cut(s) 382, 787
Csp6I GTAC 4 cut(s) 405, 682, 948, 1011
CviAII CATG 2 cut(s) 754, 1161
CviQI GTAC 4 cut(s) 405, 682, 948, 1011
DdeI CTNAG 5 cut(s) 35, 319, 612, 672, 915
DpnI GATC 3 cut(s) 576, 959, 1088
DpnII GATC 3 cut(s) 574, 957, 1086
Eam1104I CTCTTC 1 cut(s) 163
EarI CTCTTC 1 cut(s) 163
Eco32I GATATC 1 cut(s) 27
Eco47I GGWCC 2 cut(s) 382, 787
Eco57I CTGAAG 3 cut(s) 66, 144, 732
EcoRII CCWGG 3 cut(s) 108, 451, 1042
EcoRV GATATC 1 cut(s) 27
EcoT22I ATGCAT 1 cut(s) 91
FaeI CATG 2 cut(s) 757, 1164
FatI CATG 2 cut(s) 753, 1160
FbaI TGATCA 1 cut(s) 957
FblI GTMKAC 1 cut(s) 295
FokI GGATG 4 cut(s) 469, 818, 1059, 1103
FspBI CTAG 1 cut(s) 945
GlaI GCGC 1 cut(s) 1102
GsaI CCCAGC 1 cut(s) 493
HaeIII GGCC 1 cut(s) 252
HapII CCGG 1 cut(s) 265
HhaI GCGC 1 cut(s) 1103
Hin1II CATG 2 cut(s) 757, 1164
Hin6I GCGC 1 cut(s) 1101
HinP1I GCGC 1 cut(s) 1101
HincII GTYRAC 3 cut(s) 220, 296, 316
HindII GTYRAC 3 cut(s) 220, 296, 316
HinfI GANTC 3 cut(s) 242, 826, 845
HpaII CCGG 1 cut(s) 265
Hpy166II GTNNAC 4 cut(s) 220, 296, 316, 929
Hpy188I TCNGA 4 cut(s) 85, 712, 916, 1155
Hpy188III TCNNGA 3 cut(s) 22, 321, 365
Hpy8I GTNNAC 4 cut(s) 220, 296, 316, 929
Hpy99I CGWCG 1 cut(s) 297
HpyAV CCTTC 4 cut(s) 90, 629, 727, 1090
HpyCH4III ACNGT 2 cut(s) 101, 293
HpyCH4V TGCA 6 cut(s) 62, 89, 200, 356, 993, 1016
HpyF3I CTNAG 5 cut(s) 35, 319, 612, 672, 915
Hsp92II CATG 2 cut(s) 757, 1164
HspAI GCGC 1 cut(s) 1101
Ksp22I TGATCA 1 cut(s) 957
Kzo9I GATC 3 cut(s) 574, 957, 1086
LguI GCTCTTC 1 cut(s) 163
LmnI GCTCC 2 cut(s) 608, 1065
LweI GCATC 4 cut(s) 76, 187, 556, 1037
MaeI CTAG 1 cut(s) 945
MaeIII GTNAC 1 cut(s) 397
MalI GATC 3 cut(s) 576, 959, 1088
MboI GATC 3 cut(s) 574, 957, 1086
MboII GAAGA 6 cut(s) 150, 440, 472, 751, 823, 854
MfeI CAATTG 1 cut(s) 1000
MluCI AATT 7 cut(s) 180, 274, 676, 685, 908, 1000, 1149
MlyI GAGTC 1 cut(s) 835
MmeI TCCRAC 1 cut(s) 783
MnlI CCTC 4 cut(s) 537, 593, 761, 861
Mph1103I ATGCAT 1 cut(s) 91
MseI TTAA 4 cut(s) 92, 474, 557, 647
MslI CAYNNNNRTG 1 cut(s) 892
MspA1I CMGCKG 1 cut(s) 119
MspCI CTTAAG 2 cut(s) 556, 646
MspI CCGG 1 cut(s) 265
MspR9I CCNGG 3 cut(s) 110, 453, 1044
MunI CAATTG 1 cut(s) 1000
MvaI CCWGG 3 cut(s) 110, 453, 1044
MvnI CGCG 1 cut(s) 225
NdeII GATC 3 cut(s) 574, 957, 1086
NlaIII CATG 2 cut(s) 757, 1164
NsiI ATGCAT 1 cut(s) 91
PciSI GCTCTTC 1 cut(s) 163
PfeI GAWTC 2 cut(s) 242, 845
PflMI CCANNNNNTGG 1 cut(s) 542
PleI GAGTC 1 cut(s) 834
PpsI GAGTC 1 cut(s) 834
Psp6I CCWGG 3 cut(s) 108, 451, 1042
PspFI CCCAGC 1 cut(s) 489
PspGI CCWGG 3 cut(s) 108, 451, 1042
PspPI GGNCC 2 cut(s) 382, 787
PvuII CAGCTG 1 cut(s) 119
RsaI GTAC 4 cut(s) 406, 683, 949, 1012
RsaNI GTAC 4 cut(s) 405, 682, 948, 1011
RseI CAYNNNNRTG 1 cut(s) 892
SalI GTCGAC 1 cut(s) 294
SapI GCTCTTC 1 cut(s) 163
SaqAI TTAA 4 cut(s) 92, 474, 557, 647
Sau3AI GATC 3 cut(s) 574, 957, 1086
Sau96I GGNCC 2 cut(s) 382, 787
ScaI AGTACT 1 cut(s) 949
SchI GAGTC 1 cut(s) 835
ScrFI CCNGG 3 cut(s) 110, 453, 1044
SfaNI GCATC 4 cut(s) 76, 187, 556, 1037
SinI GGWCC 2 cut(s) 382, 787
SmiMI CAYNNNNRTG 1 cut(s) 892
SmlI CTYRAG 2 cut(s) 556, 646
SmoI CTYRAG 2 cut(s) 556, 646
SpeI ACTAGT 1 cut(s) 944
Sse9I AATT 7 cut(s) 180, 274, 676, 685, 908, 1000, 1149
SsiI CCGC 2 cut(s) 223, 1120
SspMI CTAG 1 cut(s) 945
StyD4I CCNGG 3 cut(s) 108, 451, 1042
TaaI ACNGT 2 cut(s) 101, 293
TaqI TCGA 1 cut(s) 295
TasI AATT 7 cut(s) 180, 274, 676, 685, 908, 1000, 1149
TatI WGTACW 3 cut(s) 681, 947, 1010
TfiI GAWTC 2 cut(s) 242, 845
Tru1I TTAA 4 cut(s) 92, 474, 557, 647
Tru9I TTAA 4 cut(s) 92, 474, 557, 647
TscAI CASTG 2 cut(s) 789, 1129
TspDTI ATGAA 7 cut(s) 36, 42, 165, 234, 473, 632, 935
TspRI CASTG 2 cut(s) 789, 1129
Van91I CCANNNNNTGG 1 cut(s) 542
Vha464I CTTAAG 2 cut(s) 556, 646
VpaK11BI GGWCC 2 cut(s) 382, 787
XapI RAATTY 5 cut(s) 180, 274, 676, 908, 1149
XcmI CCANNNNNNNNNTGG 2 cut(s) 781, 1058
XmiI GTMKAC 1 cut(s) 295
XspI CTAG 1 cut(s) 945
ZrmI AGTACT 1 cut(s) 949
Zsp2I ATGCAT 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.