Rmu_sc0005120.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005120.1
OG0000811
Physical Location & Seq
Reverse (-)
72157 .. 77504
5348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005120.1_g000016.1.cds

Sequence Viewer

Length: 1338 bp
atgggtgccacagaatcctcactctcgagctcacagaggtggccgggcgatgaaatcacgaccgtgtctgagcgatcggaggtggccgatcctatattagagaggctcaggtccctaagaatttcgacgccattactgacttcacccccaagtgagggtagcttgactgacattttagtgaggaaaccttcgtcttcttcaactcccagtattgtggatccgaaagtgttactggaactcttctcgatgtaccgtgagtggcaggaggagaatgtcaaaaggctgagccaaaaacaggaagagatagagaacaagatagaaattgcggacgcgttgtctgttaaacttaagcaacgttttaattattcagtgacagcaatgaagacatcctcgcaacatttatgtggagttcatgcactgcaggtagagattggggaacttaaaggaaggttgacggaggttattagaaactgtgatgcagtgtgcaagagaatatccgcagaaggaccagagtctcttcggattgtcaggtgtaatggggagtaccagacatcagttccaaaatgggaaccgatgtctgtaacagtaccagacatcagttccaaaatgggaaccgattaccagacatcagttccaaaatgggaaccgatgtctgtaacagtaccagacatcagttccaaaatgggaaccgattaccagacatcagttccaaaatgggaaccgatgtctgtaacagtaccagacatcagttccaaaatgggaaccgattaccagacatcagttccaaaatgggaaccgatgtctgtaacagtaccagacatcagttccaaaatgggaaccgatgtctgtaacagtaccagacatcagttccaaaatgggaaccgatccttgcttcgtcggattcgcagcctctcttcgccggattcgcagcctcagttcgccggttgctttgcagcctcggttcgccgaattcgccgcctcactttgccagcttcccagcctcgcttagctggttgcttcacagcctcccttcgctggattcgtagcctcaattcgccggttgctttgcaacctcggtttgctggattcaccgcctcacttcgcctgcttcgcagcctcgcttcgccgctcacttggccggttgctttgtcgcctagcttcgccggagcttcatcgcctagcttcgtagcctcgcttggccggctgcttcgtctcctagcttcgccggagcttcgtcgcctagcttcgcagcctcacttggcagactgcttcaccgctcacttggccggctgcttcgtcggagcttggccggctgcttcgtcacctagcttcgcctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

445

Amino Acids

48.92

Weight (kDa)

9.21

Isoelectric Point (pI)

70.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 412
AccB1I GGYRCC 1 cut(s) 5
AccBSI CCGCTC 2 cut(s) 1129, 1277
AccII CGCG 1 cut(s) 332
AciI CCGC 6 cut(s) 326, 498, 976, 1092, 1127, 1275
AclI AACGTT 1 cut(s) 355
AclWI GGATC 4 cut(s) 83, 212, 225, 879
AcoI YGGCCR 6 cut(s) 41, 84, 1136, 1198, 1284, 1307
AcsI RAATTY 2 cut(s) 120, 969
AcyI GRCGYC 1 cut(s) 128
AfaI GTAC 7 cut(s) 251, 545, 588, 663, 738, 813, 856
AfiI CCNNNNNNNGG 4 cut(s) 154, 155, 295, 1035
AflII CTTAAG 1 cut(s) 347
AflIII ACRYGT 1 cut(s) 330
AgsI TTSAA 1 cut(s) 201
AhdI GACNNNNNGTC 1 cut(s) 334
AleI CACNNNNGTG 2 cut(s) 37, 62
Alw21I GWGCWC 1 cut(s) 32
Alw26I GTCTC 2 cut(s) 519, 1217
AlwI GGATC 4 cut(s) 83, 212, 225, 879
Ama87I CYCGRG 1 cut(s) 25
AoxI GGCC 6 cut(s) 41, 84, 1136, 1198, 1284, 1307
ApeKI GCWGC 8 cut(s) 906, 928, 953, 1113, 1204, 1249, 1290, 1313
ApoI RAATTY 2 cut(s) 120, 969
AspS9I GGNCC 2 cut(s) 111, 506
AsuC2I CCSGG 1 cut(s) 45
AsuHPI GGTGA 4 cut(s) 135, 1081, 1264, 1314
AvaI CYCGRG 1 cut(s) 25
AvaII GGWCC 2 cut(s) 111, 506
BamHI GGATCC 1 cut(s) 217
BanI GGYRCC 1 cut(s) 5
BanII GRGCYC 1 cut(s) 32
BbsI GAAGAC 2 cut(s) 186, 389
Bbv12I GWGCWC 1 cut(s) 32
BbvI GCAGC 8 cut(s) 918, 940, 965, 1125, 1191, 1261, 1277, 1300
BcnI CCSGG 1 cut(s) 45
BcoDI GTCTC 2 cut(s) 519, 1217
BfaI CTAG 5 cut(s) 1155, 1179, 1217, 1241, 1326
BfmI CTRYAG 1 cut(s) 419
BfrI CTTAAG 1 cut(s) 347
BfuAI ACCTGC 1 cut(s) 412
BlpI GCTNAGC 2 cut(s) 284, 1006
Bme1390I CCNGG 1 cut(s) 45
Bme18I GGWCC 2 cut(s) 111, 506
BmeRI GACNNNNNGTC 1 cut(s) 334
BmeT110I CYCGRG 1 cut(s) 25
BmgT120I GGNCC 2 cut(s) 111, 506
BmrFI CCNGG 1 cut(s) 45
BmrI ACTGGG 1 cut(s) 201
BmsI GCATC 1 cut(s) 466
BmuI ACTGGG 1 cut(s) 201
BoxI GACNNNNGTC 1 cut(s) 511
BpiI GAAGAC 2 cut(s) 186, 389
Bpu10I CCTNAGC 1 cut(s) 107
Bpu1102I GCTNAGC 2 cut(s) 284, 1006
BpuMI CCSGG 1 cut(s) 45
BsaHI GRCGYC 1 cut(s) 128
BsaJI CCNNGG 2 cut(s) 957, 1073
Bsc4I CCNNNNNNNGG 4 cut(s) 154, 155, 295, 1035
Bse118I RCCGGY 6 cut(s) 941, 1057, 1138, 1200, 1286, 1309
Bse1I ACTGG 2 cut(s) 207, 237
Bse3DI GCAATG 1 cut(s) 384
BseDI CCNNGG 2 cut(s) 957, 1073
BseGI GGATG 1 cut(s) 386
BseLI CCNNNNNNNGG 4 cut(s) 154, 155, 295, 1035
BseMI GCAATG 1 cut(s) 384
BseMII CTCAG 4 cut(s) 60, 121, 275, 947
BseNI ACTGG 2 cut(s) 207, 237
BseRI GAGGAG 1 cut(s) 281
BseXI GCAGC 8 cut(s) 918, 940, 965, 1125, 1191, 1261, 1277, 1300
BseYI CCCAGC 1 cut(s) 996
Bsh1236I CGCG 1 cut(s) 332
Bsh1285I CGRYCG 2 cut(s) 63, 77
BshFI GGCC 6 cut(s) 43, 86, 1138, 1200, 1286, 1309
BshNI GGYRCC 1 cut(s) 5
BsiEI CGRYCG 2 cut(s) 63, 77
BsiHKAI GWGCWC 1 cut(s) 32
BsiHKCI CYCGRG 1 cut(s) 25
BslFI GGGAC 1 cut(s) 97
BslI CCNNNNNNNGG 4 cut(s) 154, 155, 295, 1035
BsmAI GTCTC 2 cut(s) 519, 1217
BsmBI CGTCTC 1 cut(s) 1217
BsmFI GGGAC 1 cut(s) 97
BsnI GGCC 6 cut(s) 43, 86, 1138, 1200, 1286, 1309
BsoBI CYCGRG 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 4 cut(s) 74, 88, 217, 884
Bsp1720I GCTNAGC 2 cut(s) 284, 1006
BspACI CCGC 6 cut(s) 326, 498, 976, 1092, 1127, 1275
BspANI GGCC 6 cut(s) 43, 86, 1138, 1200, 1286, 1309
BspCNI CTCAG 4 cut(s) 61, 120, 276, 946
BspFNI CGCG 1 cut(s) 332
BspMAI CTGCAG 1 cut(s) 423
BspMI ACCTGC 1 cut(s) 412
BspPI GGATC 4 cut(s) 83, 212, 225, 879
BspT107I GGYRCC 1 cut(s) 5
BspTI CTTAAG 1 cut(s) 347
BsrBI CCGCTC 2 cut(s) 1129, 1277
BsrDI GCAATG 1 cut(s) 384
BsrFI RCCGGY 6 cut(s) 941, 1057, 1138, 1200, 1286, 1309
BsrI ACTGG 2 cut(s) 207, 237
BssAI RCCGGY 6 cut(s) 941, 1057, 1138, 1200, 1286, 1309
BssECI CCNNGG 2 cut(s) 957, 1073
BssMI GATC 4 cut(s) 74, 88, 217, 884
BssNI GRCGYC 1 cut(s) 128
Bst4CI ACNGT 8 cut(s) 64, 254, 473, 586, 661, 736, 811, 854
Bst6I CTCTTC 4 cut(s) 245, 294, 522, 919
BstACI GRCGYC 1 cut(s) 128
BstAFI CTTAAG 1 cut(s) 347
BstC8I GCNNGC 5 cut(s) 990, 1106, 1202, 1288, 1311
BstDEI CTNAG 6 cut(s) 69, 107, 116, 284, 933, 1006
BstF5I GGATG 1 cut(s) 386
BstFNI CGCG 1 cut(s) 332
BstKTI GATC 4 cut(s) 77, 91, 220, 887
BstMAI GTCTC 2 cut(s) 519, 1217
BstMBI GATC 4 cut(s) 74, 88, 217, 884
BstMCI CGRYCG 2 cut(s) 63, 77
BstMWI GCNNNNNNNGC 7 cut(s) 925, 972, 1110, 1135, 1201, 1283, 1310
BstPAI GACNNNNGTC 1 cut(s) 511
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 419
BstUI CGCG 1 cut(s) 332
BstV1I GCAGC 8 cut(s) 918, 940, 965, 1125, 1191, 1261, 1277, 1300
BstV2I GAAGAC 2 cut(s) 186, 389
BstX2I RGATCY 1 cut(s) 217
BstXI CCANNNNNNTGG 1 cut(s) 214
BstYI RGATCY 1 cut(s) 217
BsuRI GGCC 6 cut(s) 43, 86, 1138, 1200, 1286, 1309
BtgZI GCGATG 2 cut(s) 63, 1158
BtsCI GGATG 1 cut(s) 386
BtsI GCAGTG 2 cut(s) 416, 486
BtsIMutI CAGTG 3 cut(s) 375, 416, 486
BveI ACCTGC 1 cut(s) 412
Cac8I GCNNGC 5 cut(s) 990, 1106, 1202, 1288, 1311
Cfr10I RCCGGY 6 cut(s) 941, 1057, 1138, 1200, 1286, 1309
Cfr13I GGNCC 2 cut(s) 111, 506
CseI GACGC 2 cut(s) 136, 338
Csp6I GTAC 7 cut(s) 250, 544, 587, 662, 737, 812, 855
CviAII CATG 1 cut(s) 413
CviQI GTAC 7 cut(s) 250, 544, 587, 662, 737, 812, 855
DdeI CTNAG 6 cut(s) 69, 107, 116, 284, 933, 1006
DpnI GATC 4 cut(s) 76, 90, 219, 886
DpnII GATC 4 cut(s) 74, 88, 217, 884
DriI GACNNNNNGTC 1 cut(s) 334
EaeI YGGCCR 6 cut(s) 41, 84, 1136, 1198, 1284, 1307
Eam1104I CTCTTC 4 cut(s) 245, 294, 522, 919
Eam1105I GACNNNNNGTC 1 cut(s) 334
EarI CTCTTC 4 cut(s) 245, 294, 522, 919
Ecl136II GAGCTC 1 cut(s) 30
Eco24I GRGCYC 1 cut(s) 32
Eco47I GGWCC 2 cut(s) 111, 506
Eco53kI GAGCTC 1 cut(s) 30
Eco88I CYCGRG 1 cut(s) 25
EcoICRI GAGCTC 1 cut(s) 30
EcoO109I RGGNCCY 1 cut(s) 111
EcoRI GAATTC 1 cut(s) 969
EcoT38I GRGCYC 1 cut(s) 32
Esp3I CGTCTC 1 cut(s) 1217
FaeI CATG 1 cut(s) 416
FaiI YATR 3 cut(s) 95, 403, 414
FaqI GGGAC 1 cut(s) 97
FatI CATG 1 cut(s) 412
FokI GGATG 1 cut(s) 373
FriOI GRGCYC 1 cut(s) 32
FspBI CTAG 5 cut(s) 1155, 1179, 1217, 1241, 1326
GsaI CCCAGC 1 cut(s) 1000
HaeIII GGCC 6 cut(s) 43, 86, 1138, 1200, 1286, 1309
HgaI GACGC 2 cut(s) 136, 338
Hin1I GRCGYC 1 cut(s) 128
Hin1II CATG 1 cut(s) 416
HincII GTYRAC 1 cut(s) 453
HindII GTYRAC 1 cut(s) 453
HinfI GANTC 6 cut(s) 14, 512, 901, 923, 1039, 1086
HphI GGTGA 4 cut(s) 135, 1081, 1264, 1314
Hpy166II GTNNAC 1 cut(s) 453
Hpy188I TCNGA 6 cut(s) 70, 79, 222, 522, 900, 1301
Hpy188III TCNNGA 3 cut(s) 25, 58, 244
Hpy8I GTNNAC 1 cut(s) 453
Hpy99I CGWCG 4 cut(s) 130, 900, 1239, 1301
HpyAV CCTTC 4 cut(s) 198, 441, 497, 1040
HpyCH4III ACNGT 8 cut(s) 64, 254, 473, 586, 661, 736, 811, 854
HpyCH4IV ACGT 1 cut(s) 355
HpyCH4V TGCA 6 cut(s) 416, 421, 479, 486, 953, 1069
HpyF10VI GCNNNNNNNGC 7 cut(s) 925, 972, 1110, 1135, 1201, 1283, 1310
HpyF3I CTNAG 6 cut(s) 69, 107, 116, 284, 933, 1006
HpySE526I ACGT 1 cut(s) 355
Hsp92I GRCGYC 1 cut(s) 128
Hsp92II CATG 1 cut(s) 416
KroI GCCGGC 3 cut(s) 1200, 1286, 1309
KroNI GCCGGC 3 cut(s) 1202, 1288, 1311
Kzo9I GATC 4 cut(s) 74, 88, 217, 884
LmnI GCTCC 3 cut(s) 1166, 1228, 1301
Lsp1109I GCAGC 8 cut(s) 918, 940, 965, 1125, 1191, 1261, 1277, 1300
LweI GCATC 1 cut(s) 466
MaeI CTAG 5 cut(s) 1155, 1179, 1217, 1241, 1326
MaeII ACGT 1 cut(s) 355
MaeIII GTNAC 8 cut(s) 228, 370, 580, 655, 730, 805, 848, 1320
MalI GATC 4 cut(s) 76, 90, 219, 886
MbiI CCGCTC 2 cut(s) 1129, 1277
MboI GATC 4 cut(s) 74, 88, 217, 884
MboII GAAGA 7 cut(s) 186, 189, 232, 311, 394, 509, 906
MflI RGATCY 1 cut(s) 217
MhlI GDGCHC 1 cut(s) 32
MluCI AATT 5 cut(s) 120, 321, 361, 969, 1051
MluI ACGCGT 1 cut(s) 330
MlyI GAGTC 1 cut(s) 521
MmeI TCCRAC 2 cut(s) 878, 1279
MroNI GCCGGC 3 cut(s) 1200, 1286, 1309
MseI TTAA 4 cut(s) 342, 348, 360, 441
MslI CAYNNNNRTG 4 cut(s) 37, 62, 176, 402
MspCI CTTAAG 1 cut(s) 347
MspR9I CCNGG 1 cut(s) 45
MvnI CGCG 1 cut(s) 332
MwoI GCNNNNNNNGC 7 cut(s) 925, 972, 1110, 1135, 1201, 1283, 1310
NaeI GCCGGC 3 cut(s) 1202, 1288, 1311
NciI CCSGG 1 cut(s) 45
NdeII GATC 4 cut(s) 74, 88, 217, 884
NgoMIV GCCGGC 3 cut(s) 1200, 1286, 1309
NlaIII CATG 1 cut(s) 416
NmuCI GTSAC 2 cut(s) 370, 1320
OliI CACNNNNGTG 2 cut(s) 37, 62
PaeR7I CTCGAG 1 cut(s) 25
PcsI WCGNNNNNNNCGW 1 cut(s) 1039
PdiI GCCGGC 3 cut(s) 1202, 1288, 1311
PfeI GAWTC 5 cut(s) 14, 901, 923, 1039, 1086
PflFI GACNNNGTC 1 cut(s) 64
Ple19I CGATCG 1 cut(s) 77
PleI GAGTC 1 cut(s) 520
PpsI GAGTC 1 cut(s) 520
PpuMI RGGWCCY 1 cut(s) 111
PshAI GACNNNNGTC 1 cut(s) 511
Psp124BI GAGCTC 1 cut(s) 32
Psp1406I AACGTT 1 cut(s) 355
Psp5II RGGWCCY 1 cut(s) 111
PspFI CCCAGC 1 cut(s) 996
PspPI GGNCC 2 cut(s) 111, 506
PspPPI RGGWCCY 1 cut(s) 111
PstI CTGCAG 1 cut(s) 423
PsuI RGATCY 1 cut(s) 217
PsyI GACNNNGTC 1 cut(s) 64
PvuI CGATCG 1 cut(s) 77
RsaI GTAC 7 cut(s) 251, 545, 588, 663, 738, 813, 856
RsaNI GTAC 7 cut(s) 250, 544, 587, 662, 737, 812, 855
RseI CAYNNNNRTG 4 cut(s) 37, 62, 176, 402
SacI GAGCTC 1 cut(s) 32
SaqAI TTAA 4 cut(s) 342, 348, 360, 441
Sau3AI GATC 4 cut(s) 74, 88, 217, 884
Sau96I GGNCC 2 cut(s) 111, 506
SchI GAGTC 1 cut(s) 521
ScrFI CCNGG 1 cut(s) 45
SduI GDGCHC 1 cut(s) 32
SfaNI GCATC 1 cut(s) 466
SfcI CTRYAG 1 cut(s) 419
Sfr274I CTCGAG 1 cut(s) 25
SinI GGWCC 2 cut(s) 111, 506
SlaI CTCGAG 1 cut(s) 25
SmiMI CAYNNNNRTG 4 cut(s) 37, 62, 176, 402
SmlI CTYRAG 2 cut(s) 25, 347
SmoI CTYRAG 2 cut(s) 25, 347
Sse9I AATT 5 cut(s) 120, 321, 361, 969, 1051
SsiI CCGC 6 cut(s) 326, 498, 976, 1092, 1127, 1275
SspMI CTAG 5 cut(s) 1155, 1179, 1217, 1241, 1326
SstI GAGCTC 1 cut(s) 32
StyD4I CCNGG 1 cut(s) 43
TaaI ACNGT 8 cut(s) 64, 254, 473, 586, 661, 736, 811, 854
TaiI ACGT 1 cut(s) 358
TaqI TCGA 3 cut(s) 26, 125, 245
TasI AATT 5 cut(s) 120, 321, 361, 969, 1051
TauI GCSGC 2 cut(s) 978, 1129
TfiI GAWTC 5 cut(s) 14, 901, 923, 1039, 1086
Tru1I TTAA 4 cut(s) 342, 348, 360, 441
Tru9I TTAA 4 cut(s) 342, 348, 360, 441
TscAI CASTG 3 cut(s) 375, 423, 486
TseFI GTSAC 2 cut(s) 370, 1320
TseI GCWGC 8 cut(s) 906, 928, 953, 1113, 1204, 1249, 1290, 1313
Tsp45I GTSAC 2 cut(s) 370, 1320
TspDTI ATGAA 4 cut(s) 66, 395, 401, 1161
TspGWI ACGGA 1 cut(s) 470
TspRI CASTG 3 cut(s) 375, 423, 486
Tth111I GACNNNGTC 1 cut(s) 64
Vha464I CTTAAG 1 cut(s) 347
VpaK11BI GGWCC 2 cut(s) 111, 506
XapI RAATTY 2 cut(s) 120, 969
XhoI CTCGAG 1 cut(s) 25
XspI CTAG 5 cut(s) 1155, 1179, 1217, 1241, 1326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.